Incidental Mutation 'R3934:Prpf38b'
ID306928
Institutional Source Beutler Lab
Gene Symbol Prpf38b
Ensembl Gene ENSMUSG00000027881
Gene NamePRP38 pre-mRNA processing factor 38 (yeast) domain containing B
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3934 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108902805-108911727 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 108904425 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029480] [ENSMUST00000129273] [ENSMUST00000199735]
Predicted Effect unknown
Transcript: ENSMUST00000029480
AA Change: R375G
SMART Domains Protein: ENSMUSP00000029480
Gene: ENSMUSG00000027881
AA Change: R375G

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Pfam:PRP38 48 232 5.4e-59 PFAM
low complexity region 240 253 N/A INTRINSIC
low complexity region 257 291 N/A INTRINSIC
coiled coil region 293 322 N/A INTRINSIC
low complexity region 400 439 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
low complexity region 480 506 N/A INTRINSIC
low complexity region 510 534 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127478
Predicted Effect probably benign
Transcript: ENSMUST00000129273
SMART Domains Protein: ENSMUSP00000143724
Gene: ENSMUSG00000027881

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Pfam:PRP38 48 93 2.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197805
Predicted Effect probably benign
Transcript: ENSMUST00000199735
SMART Domains Protein: ENSMUSP00000142929
Gene: ENSMUSG00000027881

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Pfam:PRP38 43 150 2e-16 PFAM
Meta Mutation Damage Score 0.0823 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik T A 12: 18,534,081 Y381N possibly damaging Het
Adgrf3 T C 5: 30,200,434 probably benign Het
Adgrv1 A G 13: 81,475,047 F3819S probably benign Het
Aig1 T C 10: 13,801,912 D112G probably damaging Het
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
C2cd5 C T 6: 143,041,380 V499I possibly damaging Het
Capn11 A T 17: 45,634,287 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Enpp2 A G 15: 54,845,921 V766A probably benign Het
Fastk G T 5: 24,442,259 S317* probably null Het
Fgfr1op2 T A 6: 146,595,171 probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hectd4 G A 5: 121,320,101 probably null Het
Hmcn2 T A 2: 31,380,484 probably null Het
Hspbp1 A T 7: 4,664,595 M271K probably benign Het
Itgb6 G A 2: 60,611,411 T685M possibly damaging Het
Itih5 G A 2: 10,245,544 V685I probably damaging Het
Kalrn T C 16: 34,310,531 S421G probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Perm1 A G 4: 156,219,170 T724A probably benign Het
Pex5l T C 3: 33,007,172 E176G probably damaging Het
Polk A T 13: 96,501,635 M192K possibly damaging Het
Polr3a T C 14: 24,476,101 I401V probably benign Het
Sema3c T C 5: 17,681,940 S330P probably damaging Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc39a12 T A 2: 14,434,363 probably benign Het
Sod3 T C 5: 52,368,645 S229P probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Spink5 G T 18: 44,016,427 K958N probably damaging Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ush2a T A 1: 188,263,511 probably null Het
Vmn2r19 T A 6: 123,315,669 D223E probably damaging Het
Vwf T A 6: 125,555,499 S87T probably damaging Het
Wdr35 G T 12: 9,008,014 G513C probably damaging Het
Other mutations in Prpf38b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01944:Prpf38b APN 3 108904675 missense probably benign 0.23
IGL03145:Prpf38b APN 3 108903945 utr 3 prime probably benign
IGL03269:Prpf38b APN 3 108905241 missense probably benign 0.23
R0482:Prpf38b UTSW 3 108905270 missense probably damaging 1.00
R0765:Prpf38b UTSW 3 108911418 missense possibly damaging 0.53
R3724:Prpf38b UTSW 3 108904340 utr 3 prime probably benign
R4367:Prpf38b UTSW 3 108911171 missense probably damaging 1.00
R4649:Prpf38b UTSW 3 108904092 utr 3 prime probably benign
R4651:Prpf38b UTSW 3 108904092 utr 3 prime probably benign
R4653:Prpf38b UTSW 3 108904092 utr 3 prime probably benign
R5073:Prpf38b UTSW 3 108911168 missense probably damaging 1.00
R6795:Prpf38b UTSW 3 108904664 utr 3 prime probably benign
R6979:Prpf38b UTSW 3 108911324 missense probably benign 0.01
R7500:Prpf38b UTSW 3 108905130 missense probably benign 0.33
R8045:Prpf38b UTSW 3 108904034 missense not run
Predicted Primers PCR Primer
(F):5'- ACTTCTCTCTGCTAGGGCTG -3'
(R):5'- ATCCCGAAGCATTGATCGG -3'

Sequencing Primer
(F):5'- AACACTGCCAGTTCTTCCTTGAC -3'
(R):5'- AAGCATTGATCGGGGCTTAGATC -3'
Posted On2015-04-17