Incidental Mutation 'R3934:Perm1'
ID 306929
Institutional Source Beutler Lab
Gene Symbol Perm1
Ensembl Gene ENSMUSG00000078486
Gene Name PPARGC1 and ESRR induced regulator, muscle 1
Synonyms 2310042D19Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R3934 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 156300325-156305764 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 156303627 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 724 (T724A)
Ref Sequence ENSEMBL: ENSMUSP00000101197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105571] [ENSMUST00000105572] [ENSMUST00000217885] [ENSMUST00000218699]
AlphaFold Q149B8
Predicted Effect probably benign
Transcript: ENSMUST00000105571
SMART Domains Protein: ENSMUSP00000101196
Gene: ENSMUSG00000078485

DomainStartEndE-ValueType
PH 96 192 4.6e-4 SMART
PH 227 324 8.34e-2 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105572
AA Change: T724A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101197
Gene: ENSMUSG00000078486
AA Change: T724A

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 145 160 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 544 553 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 790 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217885
Predicted Effect probably benign
Transcript: ENSMUST00000218699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219227
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik T A 12: 18,584,082 (GRCm39) Y381N possibly damaging Het
Adgrf3 T C 5: 30,405,432 (GRCm39) probably benign Het
Adgrv1 A G 13: 81,623,166 (GRCm39) F3819S probably benign Het
Aig1 T C 10: 13,677,656 (GRCm39) D112G probably damaging Het
Akap6 C T 12: 53,187,227 (GRCm39) T1547M possibly damaging Het
Alk T A 17: 72,512,949 (GRCm39) I337F probably damaging Het
C2cd5 C T 6: 142,987,106 (GRCm39) V499I possibly damaging Het
Capn11 A T 17: 45,945,213 (GRCm39) probably benign Het
Clstn3 G A 6: 124,434,901 (GRCm39) T338I probably damaging Het
Cmbl A G 15: 31,589,933 (GRCm39) D221G possibly damaging Het
Enpp2 A G 15: 54,709,317 (GRCm39) V766A probably benign Het
Fastk G T 5: 24,647,257 (GRCm39) S317* probably null Het
Fgfr1op2 T A 6: 146,496,669 (GRCm39) probably benign Het
Gpr85 A G 6: 13,836,044 (GRCm39) F287L probably benign Het
Hectd4 G A 5: 121,458,164 (GRCm39) probably null Het
Hmcn2 T A 2: 31,270,496 (GRCm39) probably null Het
Hspbp1 A T 7: 4,667,594 (GRCm39) M271K probably benign Het
Itgb6 G A 2: 60,441,755 (GRCm39) T685M possibly damaging Het
Itih5 G A 2: 10,250,355 (GRCm39) V685I probably damaging Het
Kalrn T C 16: 34,130,901 (GRCm39) S421G probably benign Het
Mcm2 G A 6: 88,869,990 (GRCm39) R60C probably damaging Het
Mitf C T 6: 97,970,214 (GRCm39) P54S probably damaging Het
Pex5l T C 3: 33,061,321 (GRCm39) E176G probably damaging Het
Polk A T 13: 96,638,143 (GRCm39) M192K possibly damaging Het
Polr3a T C 14: 24,526,169 (GRCm39) I401V probably benign Het
Prpf38b T C 3: 108,811,741 (GRCm39) probably benign Het
Sema3c T C 5: 17,886,938 (GRCm39) S330P probably damaging Het
Slc16a7 C A 10: 125,066,712 (GRCm39) R309L probably damaging Het
Slc35f1 C T 10: 52,984,314 (GRCm39) T358I probably damaging Het
Slc39a12 T A 2: 14,439,174 (GRCm39) probably benign Het
Sod3 T C 5: 52,525,987 (GRCm39) S229P probably benign Het
Sorcs3 T A 19: 48,701,943 (GRCm39) V608D probably damaging Het
Spink5 G T 18: 44,149,494 (GRCm39) K958N probably damaging Het
Ttc7 A C 17: 87,678,166 (GRCm39) probably benign Het
Ush2a T A 1: 187,995,708 (GRCm39) probably null Het
Vmn2r19 T A 6: 123,292,628 (GRCm39) D223E probably damaging Het
Vwf T A 6: 125,532,462 (GRCm39) S87T probably damaging Het
Wdr35 G T 12: 9,058,014 (GRCm39) G513C probably damaging Het
Other mutations in Perm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01967:Perm1 APN 4 156,302,118 (GRCm39) missense probably damaging 0.99
IGL01970:Perm1 APN 4 156,302,118 (GRCm39) missense probably damaging 0.99
IGL02143:Perm1 APN 4 156,302,500 (GRCm39) missense probably benign 0.09
IGL02644:Perm1 APN 4 156,303,043 (GRCm39) missense probably damaging 1.00
IGL02993:Perm1 APN 4 156,302,236 (GRCm39) missense probably benign 0.20
PIT4366001:Perm1 UTSW 4 156,303,192 (GRCm39) missense probably benign 0.11
R0052:Perm1 UTSW 4 156,302,572 (GRCm39) missense probably damaging 1.00
R0105:Perm1 UTSW 4 156,302,682 (GRCm39) missense probably benign 0.23
R0566:Perm1 UTSW 4 156,302,316 (GRCm39) missense probably benign 0.10
R1184:Perm1 UTSW 4 156,301,771 (GRCm39) missense probably damaging 1.00
R1208:Perm1 UTSW 4 156,301,459 (GRCm39) start codon destroyed probably null 0.92
R1244:Perm1 UTSW 4 156,302,340 (GRCm39) missense probably benign 0.09
R1724:Perm1 UTSW 4 156,302,529 (GRCm39) missense possibly damaging 0.82
R1783:Perm1 UTSW 4 156,302,988 (GRCm39) nonsense probably null
R1817:Perm1 UTSW 4 156,303,061 (GRCm39) missense possibly damaging 0.59
R1892:Perm1 UTSW 4 156,302,340 (GRCm39) missense probably benign 0.09
R1893:Perm1 UTSW 4 156,302,340 (GRCm39) missense probably benign 0.09
R2106:Perm1 UTSW 4 156,303,336 (GRCm39) missense probably damaging 1.00
R2567:Perm1 UTSW 4 156,301,575 (GRCm39) missense probably damaging 0.99
R3752:Perm1 UTSW 4 156,302,403 (GRCm39) missense probably benign 0.01
R4509:Perm1 UTSW 4 156,302,043 (GRCm39) missense probably benign 0.02
R4667:Perm1 UTSW 4 156,304,663 (GRCm39) nonsense probably null
R4706:Perm1 UTSW 4 156,301,531 (GRCm39) missense probably damaging 0.99
R4812:Perm1 UTSW 4 156,303,193 (GRCm39) missense possibly damaging 0.59
R4979:Perm1 UTSW 4 156,302,034 (GRCm39) missense probably benign 0.01
R5275:Perm1 UTSW 4 156,301,975 (GRCm39) missense probably benign
R5295:Perm1 UTSW 4 156,301,975 (GRCm39) missense probably benign
R5425:Perm1 UTSW 4 156,302,752 (GRCm39) missense probably benign 0.04
R6125:Perm1 UTSW 4 156,302,176 (GRCm39) missense probably benign 0.00
R6573:Perm1 UTSW 4 156,303,130 (GRCm39) missense probably damaging 1.00
R6721:Perm1 UTSW 4 156,302,776 (GRCm39) missense probably benign 0.00
R6986:Perm1 UTSW 4 156,302,976 (GRCm39) nonsense probably null
R7190:Perm1 UTSW 4 156,304,272 (GRCm39) missense possibly damaging 0.84
R7561:Perm1 UTSW 4 156,303,217 (GRCm39) missense probably benign
R7578:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R7769:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R7876:Perm1 UTSW 4 156,302,046 (GRCm39) missense probably damaging 0.98
R7899:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R7943:Perm1 UTSW 4 156,302,991 (GRCm39) missense probably damaging 0.98
R7979:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R8217:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R8352:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R8680:Perm1 UTSW 4 156,302,091 (GRCm39) missense probably benign
R8719:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R8753:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R8847:Perm1 UTSW 4 156,302,068 (GRCm39) missense probably benign
R9170:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R9231:Perm1 UTSW 4 156,302,234 (GRCm39) missense probably damaging 0.98
R9255:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R9259:Perm1 UTSW 4 156,303,607 (GRCm39) missense probably benign 0.33
R9410:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R9465:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R9492:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R9501:Perm1 UTSW 4 156,302,177 (GRCm39) missense probably benign 0.32
R9518:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R9548:Perm1 UTSW 4 156,302,290 (GRCm39) missense probably benign 0.02
R9569:Perm1 UTSW 4 156,303,039 (GRCm39) missense probably benign 0.13
R9576:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCCAATGGCCTGACACATGC -3'
(R):5'- AAGTGTCTGGCTTGAGCTGC -3'

Sequencing Primer
(F):5'- TGTCAGAGGGGACACTCTC -3'
(R):5'- GGCTTGAGCTGCCCAATCTTAAATG -3'
Posted On 2015-04-17