Incidental Mutation 'R3934:Perm1'
ID 306929
Institutional Source Beutler Lab
Gene Symbol Perm1
Ensembl Gene ENSMUSG00000078486
Gene Name PPARGC1 and ESRR induced regulator, muscle 1
Synonyms 2310042D19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R3934 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 156215868-156221307 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 156219170 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 724 (T724A)
Ref Sequence ENSEMBL: ENSMUSP00000101197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105571] [ENSMUST00000105572] [ENSMUST00000217885] [ENSMUST00000218699]
AlphaFold Q149B8
Predicted Effect probably benign
Transcript: ENSMUST00000105571
SMART Domains Protein: ENSMUSP00000101196
Gene: ENSMUSG00000078485

DomainStartEndE-ValueType
PH 96 192 4.6e-4 SMART
PH 227 324 8.34e-2 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105572
AA Change: T724A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101197
Gene: ENSMUSG00000078486
AA Change: T724A

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 145 160 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 544 553 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 790 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217885
Predicted Effect probably benign
Transcript: ENSMUST00000218699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219227
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik T A 12: 18,534,081 Y381N possibly damaging Het
Adgrf3 T C 5: 30,200,434 probably benign Het
Adgrv1 A G 13: 81,475,047 F3819S probably benign Het
Aig1 T C 10: 13,801,912 D112G probably damaging Het
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
C2cd5 C T 6: 143,041,380 V499I possibly damaging Het
Capn11 A T 17: 45,634,287 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Enpp2 A G 15: 54,845,921 V766A probably benign Het
Fastk G T 5: 24,442,259 S317* probably null Het
Fgfr1op2 T A 6: 146,595,171 probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hectd4 G A 5: 121,320,101 probably null Het
Hmcn2 T A 2: 31,380,484 probably null Het
Hspbp1 A T 7: 4,664,595 M271K probably benign Het
Itgb6 G A 2: 60,611,411 T685M possibly damaging Het
Itih5 G A 2: 10,245,544 V685I probably damaging Het
Kalrn T C 16: 34,310,531 S421G probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Pex5l T C 3: 33,007,172 E176G probably damaging Het
Polk A T 13: 96,501,635 M192K possibly damaging Het
Polr3a T C 14: 24,476,101 I401V probably benign Het
Prpf38b T C 3: 108,904,425 probably benign Het
Sema3c T C 5: 17,681,940 S330P probably damaging Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc39a12 T A 2: 14,434,363 probably benign Het
Sod3 T C 5: 52,368,645 S229P probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Spink5 G T 18: 44,016,427 K958N probably damaging Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ush2a T A 1: 188,263,511 probably null Het
Vmn2r19 T A 6: 123,315,669 D223E probably damaging Het
Vwf T A 6: 125,555,499 S87T probably damaging Het
Wdr35 G T 12: 9,008,014 G513C probably damaging Het
Other mutations in Perm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01967:Perm1 APN 4 156217661 missense probably damaging 0.99
IGL01970:Perm1 APN 4 156217661 missense probably damaging 0.99
IGL02143:Perm1 APN 4 156218043 missense probably benign 0.09
IGL02644:Perm1 APN 4 156218586 missense probably damaging 1.00
IGL02993:Perm1 APN 4 156217779 missense probably benign 0.20
PIT4366001:Perm1 UTSW 4 156218735 missense probably benign 0.11
R0052:Perm1 UTSW 4 156218115 missense probably damaging 1.00
R0105:Perm1 UTSW 4 156218225 missense probably benign 0.23
R0566:Perm1 UTSW 4 156217859 missense probably benign 0.10
R1184:Perm1 UTSW 4 156217314 missense probably damaging 1.00
R1208:Perm1 UTSW 4 156217002 start codon destroyed probably null 0.92
R1244:Perm1 UTSW 4 156217883 missense probably benign 0.09
R1724:Perm1 UTSW 4 156218072 missense possibly damaging 0.82
R1783:Perm1 UTSW 4 156218531 nonsense probably null
R1817:Perm1 UTSW 4 156218604 missense possibly damaging 0.59
R1892:Perm1 UTSW 4 156217883 missense probably benign 0.09
R1893:Perm1 UTSW 4 156217883 missense probably benign 0.09
R2106:Perm1 UTSW 4 156218879 missense probably damaging 1.00
R2567:Perm1 UTSW 4 156217118 missense probably damaging 0.99
R3752:Perm1 UTSW 4 156217946 missense probably benign 0.01
R4509:Perm1 UTSW 4 156217586 missense probably benign 0.02
R4667:Perm1 UTSW 4 156220206 nonsense probably null
R4706:Perm1 UTSW 4 156217074 missense probably damaging 0.99
R4812:Perm1 UTSW 4 156218736 missense possibly damaging 0.59
R4979:Perm1 UTSW 4 156217577 missense probably benign 0.01
R5275:Perm1 UTSW 4 156217518 missense probably benign
R5295:Perm1 UTSW 4 156217518 missense probably benign
R5425:Perm1 UTSW 4 156218295 missense probably benign 0.04
R6125:Perm1 UTSW 4 156217719 missense probably benign 0.00
R6573:Perm1 UTSW 4 156218673 missense probably damaging 1.00
R6721:Perm1 UTSW 4 156218319 missense probably benign 0.00
R6986:Perm1 UTSW 4 156218519 nonsense probably null
R7190:Perm1 UTSW 4 156219815 missense possibly damaging 0.84
R7561:Perm1 UTSW 4 156218760 missense probably benign
R7578:Perm1 UTSW 4 156218068 unclassified probably benign
R7769:Perm1 UTSW 4 156218068 unclassified probably benign
R7876:Perm1 UTSW 4 156217589 missense probably damaging 0.98
R7899:Perm1 UTSW 4 156218068 unclassified probably benign
R7943:Perm1 UTSW 4 156218534 missense probably damaging 0.98
R7979:Perm1 UTSW 4 156218068 unclassified probably benign
R8217:Perm1 UTSW 4 156218068 unclassified probably benign
R8352:Perm1 UTSW 4 156218068 unclassified probably benign
R8680:Perm1 UTSW 4 156217634 missense probably benign
R8719:Perm1 UTSW 4 156218068 unclassified probably benign
R8753:Perm1 UTSW 4 156218068 unclassified probably benign
R8847:Perm1 UTSW 4 156217611 missense probably benign
R9170:Perm1 UTSW 4 156218068 unclassified probably benign
R9231:Perm1 UTSW 4 156217777 missense probably damaging 0.98
R9255:Perm1 UTSW 4 156218068 unclassified probably benign
R9259:Perm1 UTSW 4 156219150 missense probably benign 0.33
R9410:Perm1 UTSW 4 156218068 unclassified probably benign
R9465:Perm1 UTSW 4 156218068 unclassified probably benign
R9492:Perm1 UTSW 4 156218068 unclassified probably benign
R9501:Perm1 UTSW 4 156217720 missense probably benign 0.32
R9518:Perm1 UTSW 4 156218068 unclassified probably benign
R9548:Perm1 UTSW 4 156217833 missense probably benign 0.02
R9569:Perm1 UTSW 4 156218582 missense probably benign 0.13
R9576:Perm1 UTSW 4 156218068 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCCAATGGCCTGACACATGC -3'
(R):5'- AAGTGTCTGGCTTGAGCTGC -3'

Sequencing Primer
(F):5'- TGTCAGAGGGGACACTCTC -3'
(R):5'- GGCTTGAGCTGCCCAATCTTAAATG -3'
Posted On 2015-04-17