Incidental Mutation 'R3934:Fastk'
ID306931
Institutional Source Beutler Lab
Gene Symbol Fastk
Ensembl Gene ENSMUSG00000028959
Gene NameFas-activated serine/threonine kinase
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3934 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24438440-24445287 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 24442259 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 317 (S317*)
Ref Sequence ENSEMBL: ENSMUSP00000110695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030799] [ENSMUST00000030800] [ENSMUST00000080067] [ENSMUST00000115033] [ENSMUST00000115036] [ENSMUST00000115041] [ENSMUST00000115043] [ENSMUST00000115047] [ENSMUST00000115049] [ENSMUST00000123167] [ENSMUST00000127194] [ENSMUST00000144389]
Predicted Effect probably benign
Transcript: ENSMUST00000030799
SMART Domains Protein: ENSMUSP00000030799
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000030800
AA Change: S317*
SMART Domains Protein: ENSMUSP00000030800
Gene: ENSMUSG00000028959
AA Change: S317*

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Pfam:FAST_1 274 340 7.4e-18 PFAM
Pfam:FAST_2 351 440 5e-20 PFAM
RAP 475 532 3.04e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080067
SMART Domains Protein: ENSMUSP00000078972
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 93 110 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
low complexity region 138 151 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 296 313 N/A INTRINSIC
Pfam:Band_3_cyto 348 616 4.7e-111 PFAM
Pfam:HCO3_cotransp 671 1165 1.7e-217 PFAM
transmembrane domain 1183 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115033
SMART Domains Protein: ENSMUSP00000110685
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115036
SMART Domains Protein: ENSMUSP00000110688
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
UBQ 117 186 4.58e-4 SMART
low complexity region 190 206 N/A INTRINSIC
transmembrane domain 207 229 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115041
AA Change: S180*
SMART Domains Protein: ENSMUSP00000110693
Gene: ENSMUSG00000028959
AA Change: S180*

DomainStartEndE-ValueType
low complexity region 43 57 N/A INTRINSIC
low complexity region 101 112 N/A INTRINSIC
Pfam:FAST_1 136 204 5.4e-24 PFAM
Pfam:FAST_2 212 303 4.7e-26 PFAM
RAP 338 395 3.04e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115043
AA Change: S317*
SMART Domains Protein: ENSMUSP00000110695
Gene: ENSMUSG00000028959
AA Change: S317*

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Pfam:FAST_1 273 341 7.6e-24 PFAM
Pfam:FAST_2 349 440 6.9e-26 PFAM
Pfam:RAP 475 513 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115047
SMART Domains Protein: ENSMUSP00000110699
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 79 96 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
low complexity region 124 137 N/A INTRINSIC
low complexity region 155 164 N/A INTRINSIC
low complexity region 186 202 N/A INTRINSIC
low complexity region 282 299 N/A INTRINSIC
Pfam:Band_3_cyto 334 602 7.2e-108 PFAM
Pfam:HCO3_cotransp 656 1151 1e-244 PFAM
transmembrane domain 1169 1186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115049
SMART Domains Protein: ENSMUSP00000110701
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 84 101 N/A INTRINSIC
low complexity region 103 126 N/A INTRINSIC
low complexity region 129 142 N/A INTRINSIC
low complexity region 160 169 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Band_3_cyto 339 607 7.3e-108 PFAM
Pfam:HCO3_cotransp 661 1156 1e-244 PFAM
transmembrane domain 1174 1191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123144
Predicted Effect probably benign
Transcript: ENSMUST00000123167
SMART Domains Protein: ENSMUSP00000122487
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
Blast:UBQ 102 122 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127194
SMART Domains Protein: ENSMUSP00000123173
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
low complexity region 175 204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140722
Predicted Effect probably benign
Transcript: ENSMUST00000144389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198786
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase was shown to be activated rapidly during Fas-mediated apoptosis in Jurkat cells. In response to Fas receptor ligation, it phosphorylates TIA1, an apoptosis-promoting nuclear RNA-binding protein. The encoded protein is a strong inducer of lymphocyte apoptosis. Two transcript variants encoding different isoforms have been found for this gene. Other variants exist, but their full-length natures have not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele lack neutophil infiltration in a model of house dust mite induced allergic pulmonary inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik T A 12: 18,534,081 Y381N possibly damaging Het
Adgrf3 T C 5: 30,200,434 probably benign Het
Adgrv1 A G 13: 81,475,047 F3819S probably benign Het
Aig1 T C 10: 13,801,912 D112G probably damaging Het
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
C2cd5 C T 6: 143,041,380 V499I possibly damaging Het
Capn11 A T 17: 45,634,287 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Enpp2 A G 15: 54,845,921 V766A probably benign Het
Fgfr1op2 T A 6: 146,595,171 probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hectd4 G A 5: 121,320,101 probably null Het
Hmcn2 T A 2: 31,380,484 probably null Het
Hspbp1 A T 7: 4,664,595 M271K probably benign Het
Itgb6 G A 2: 60,611,411 T685M possibly damaging Het
Itih5 G A 2: 10,245,544 V685I probably damaging Het
Kalrn T C 16: 34,310,531 S421G probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Perm1 A G 4: 156,219,170 T724A probably benign Het
Pex5l T C 3: 33,007,172 E176G probably damaging Het
Polk A T 13: 96,501,635 M192K possibly damaging Het
Polr3a T C 14: 24,476,101 I401V probably benign Het
Prpf38b T C 3: 108,904,425 probably benign Het
Sema3c T C 5: 17,681,940 S330P probably damaging Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc39a12 T A 2: 14,434,363 probably benign Het
Sod3 T C 5: 52,368,645 S229P probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Spink5 G T 18: 44,016,427 K958N probably damaging Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ush2a T A 1: 188,263,511 probably null Het
Vmn2r19 T A 6: 123,315,669 D223E probably damaging Het
Vwf T A 6: 125,555,499 S87T probably damaging Het
Wdr35 G T 12: 9,008,014 G513C probably damaging Het
Other mutations in Fastk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02149:Fastk APN 5 24444053 missense probably damaging 0.99
IGL02313:Fastk APN 5 24443092 missense probably damaging 1.00
IGL02374:Fastk APN 5 24444249 missense possibly damaging 0.48
R0244:Fastk UTSW 5 24442178 splice site probably benign
R0733:Fastk UTSW 5 24443923 missense probably null 0.61
R1181:Fastk UTSW 5 24441731 critical splice donor site probably null
R1558:Fastk UTSW 5 24444047 unclassified probably null
R1735:Fastk UTSW 5 24441803 missense probably damaging 1.00
R1815:Fastk UTSW 5 24441531 missense probably damaging 1.00
R2134:Fastk UTSW 5 24445141 missense probably damaging 0.99
R4608:Fastk UTSW 5 24443119 missense probably damaging 1.00
R6671:Fastk UTSW 5 24441609 missense probably damaging 0.99
X0022:Fastk UTSW 5 24444278 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCCACAGCCGTATCGAGTAG -3'
(R):5'- TTTCCTGCTGGATAATGTTGCC -3'

Sequencing Primer
(F):5'- AGGTAGCGTCGCACAATC -3'
(R):5'- CCTTTTTCTGCAGGTGGTACAGAAG -3'
Posted On2015-04-17