Incidental Mutation 'R3934:Gpr85'
ID306934
Institutional Source Beutler Lab
Gene Symbol Gpr85
Ensembl Gene ENSMUSG00000048216
Gene NameG protein-coupled receptor 85
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R3934 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location13834458-13839942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13836045 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 287 (F287L)
Ref Sequence ENSEMBL: ENSMUSP00000111155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060442] [ENSMUST00000115491] [ENSMUST00000115492]
Predicted Effect probably benign
Transcript: ENSMUST00000060442
AA Change: F287L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000053837
Gene: ENSMUSG00000048216
AA Change: F287L

DomainStartEndE-ValueType
Pfam:7tm_1 37 338 4.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115491
AA Change: F287L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000111154
Gene: ENSMUSG00000048216
AA Change: F287L

DomainStartEndE-ValueType
Pfam:7tm_1 37 338 4.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115492
AA Change: F287L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000111155
Gene: ENSMUSG00000048216
AA Change: F287L

DomainStartEndE-ValueType
Pfam:7tm_1 37 338 1.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127072
Meta Mutation Damage Score 0.1429 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the G protein-coupled receptor (GPCR) family, such as GPR85, have a similar structure characterized by 7 transmembrane domains. Activation of GPCRs by extracellular stimuli, such as neurotransmitters, hormones, or light, induces an intracellular signaling cascade mediated by heterotrimeric GTP-binding proteins, or G proteins (Matsumoto et al., 2000 [PubMed 10833454]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a significant increase in brain weight and enhanced contextual memory in a fear-conditioning task but no additional behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik T A 12: 18,534,081 Y381N possibly damaging Het
Adgrf3 T C 5: 30,200,434 probably benign Het
Adgrv1 A G 13: 81,475,047 F3819S probably benign Het
Aig1 T C 10: 13,801,912 D112G probably damaging Het
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
C2cd5 C T 6: 143,041,380 V499I possibly damaging Het
Capn11 A T 17: 45,634,287 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Enpp2 A G 15: 54,845,921 V766A probably benign Het
Fastk G T 5: 24,442,259 S317* probably null Het
Fgfr1op2 T A 6: 146,595,171 probably benign Het
Hectd4 G A 5: 121,320,101 probably null Het
Hmcn2 T A 2: 31,380,484 probably null Het
Hspbp1 A T 7: 4,664,595 M271K probably benign Het
Itgb6 G A 2: 60,611,411 T685M possibly damaging Het
Itih5 G A 2: 10,245,544 V685I probably damaging Het
Kalrn T C 16: 34,310,531 S421G probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Perm1 A G 4: 156,219,170 T724A probably benign Het
Pex5l T C 3: 33,007,172 E176G probably damaging Het
Polk A T 13: 96,501,635 M192K possibly damaging Het
Polr3a T C 14: 24,476,101 I401V probably benign Het
Prpf38b T C 3: 108,904,425 probably benign Het
Sema3c T C 5: 17,681,940 S330P probably damaging Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc39a12 T A 2: 14,434,363 probably benign Het
Sod3 T C 5: 52,368,645 S229P probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Spink5 G T 18: 44,016,427 K958N probably damaging Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ush2a T A 1: 188,263,511 probably null Het
Vmn2r19 T A 6: 123,315,669 D223E probably damaging Het
Vwf T A 6: 125,555,499 S87T probably damaging Het
Wdr35 G T 12: 9,008,014 G513C probably damaging Het
Other mutations in Gpr85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02414:Gpr85 APN 6 13836910 utr 5 prime probably benign
R0784:Gpr85 UTSW 6 13836749 missense probably benign 0.25
R1356:Gpr85 UTSW 6 13836147 missense probably benign 0.42
R2343:Gpr85 UTSW 6 13836696 missense probably damaging 1.00
R3935:Gpr85 UTSW 6 13836045 missense probably benign 0.02
R3936:Gpr85 UTSW 6 13836045 missense probably benign 0.02
R4925:Gpr85 UTSW 6 13835978 missense probably benign 0.26
R5313:Gpr85 UTSW 6 13836302 missense probably damaging 1.00
R5586:Gpr85 UTSW 6 13836001 nonsense probably null
R7043:Gpr85 UTSW 6 13835877 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAGTAAAGAAGGGTTGTGC -3'
(R):5'- AGTCAGAACTGGACCTTTCATGG -3'

Sequencing Primer
(F):5'- TGAAACAGCGCCTCAGC -3'
(R):5'- CTTTCATGGCCCTGGAGCTAG -3'
Posted On2015-04-17