Mutagenetix > Incidental Mutations

Incidental Mutation 'R3934:Clstn3'

306938

Institutional Source

Beutler Lab

Gene Symbol

Clstn3

Ensembl Gene

ENSMUSG00000008153

Gene Name

calsyntenin 3

Synonyms

alcadein-beta, Cst-3, CSTN3

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3934 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124430759-124464794 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 124457942 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 338 (T338I)

Ref Sequence

ENSEMBL: ENSMUSP00000108142 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523] [ENSMUST00000150774]

Predicted Effect

probably damaging
Transcript: ENSMUST00000008297
AA Change: T375I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153
AA Change: T375I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
CA	50	143	2.72e-12	SMART
CA	166	244	4.04e-2	SMART
SCOP:d1a8d_1	333	549	7e-23	SMART
transmembrane domain	846	868	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112523
AA Change: T338I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153
AA Change: T338I

Domain	Start	End	E-Value	Type
CA	13	106	2.72e-12	SMART
CA	129	207	4.04e-2	SMART
Pfam:Laminin_G_3	304	505	4.1e-8	PFAM
transmembrane domain	809	831	N/A	INTRINSIC
low complexity region	891	908	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000150774

SMART Domains

Protein: ENSMUSP00000145422
Gene: ENSMUSG00000008153

Domain	Start	End	E-Value	Type
Blast:CA	13	64	4e-31	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156040

Meta Mutation Damage Score

0.3507

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

100% (40/40)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730507C01Rik	T	A	12: 18,534,081	Y381N	possibly damaging	Het
Adgrf3	T	C	5: 30,200,434		probably benign	Het
Adgrv1	A	G	13: 81,475,047	F3819S	probably benign	Het
Aig1	T	C	10: 13,801,912	D112G	probably damaging	Het
Akap6	C	T	12: 53,140,444	T1547M	possibly damaging	Het
Alk	T	A	17: 72,205,954	I337F	probably damaging	Het
C2cd5	C	T	6: 143,041,380	V499I	possibly damaging	Het
Capn11	A	T	17: 45,634,287		probably benign	Het
Cmbl	A	G	15: 31,589,787	D221G	possibly damaging	Het
Enpp2	A	G	15: 54,845,921	V766A	probably benign	Het
Fastk	G	T	5: 24,442,259	S317*	probably null	Het
Fgfr1op2	T	A	6: 146,595,171		probably benign	Het
Gpr85	A	G	6: 13,836,045	F287L	probably benign	Het
Hectd4	G	A	5: 121,320,101		probably null	Het
Hmcn2	T	A	2: 31,380,484		probably null	Het
Hspbp1	A	T	7: 4,664,595	M271K	probably benign	Het
Itgb6	G	A	2: 60,611,411	T685M	possibly damaging	Het
Itih5	G	A	2: 10,245,544	V685I	probably damaging	Het
Kalrn	T	C	16: 34,310,531	S421G	probably benign	Het
Mcm2	G	A	6: 88,893,008	R60C	probably damaging	Het
Mitf	C	T	6: 97,993,253	P54S	probably damaging	Het
Perm1	A	G	4: 156,219,170	T724A	probably benign	Het
Pex5l	T	C	3: 33,007,172	E176G	probably damaging	Het
Polk	A	T	13: 96,501,635	M192K	possibly damaging	Het
Polr3a	T	C	14: 24,476,101	I401V	probably benign	Het
Prpf38b	T	C	3: 108,904,425		probably benign	Het
Sema3c	T	C	5: 17,681,940	S330P	probably damaging	Het
Slc16a7	C	A	10: 125,230,843	R309L	probably damaging	Het
Slc35f1	C	T	10: 53,108,218	T358I	probably damaging	Het
Slc39a12	T	A	2: 14,434,363		probably benign	Het
Sod3	T	C	5: 52,368,645	S229P	probably benign	Het
Sorcs3	T	A	19: 48,713,504	V608D	probably damaging	Het
Spink5	G	T	18: 44,016,427	K958N	probably damaging	Het
Ttc7	A	C	17: 87,370,738		probably benign	Het
Ush2a	T	A	1: 188,263,511		probably null	Het
Vmn2r19	T	A	6: 123,315,669	D223E	probably damaging	Het
Vwf	T	A	6: 125,555,499	S87T	probably damaging	Het
Wdr35	G	T	12: 9,008,014	G513C	probably damaging	Het

Other mutations in Clstn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Clstn3	APN	6	124462139	missense	probably damaging	1.00
IGL01415:Clstn3	APN	6	124438822	nonsense	probably null
IGL01521:Clstn3	APN	6	124458031	nonsense	probably null
IGL01537:Clstn3	APN	6	124431600	missense	possibly damaging	0.91
IGL01729:Clstn3	APN	6	124449794	missense	probably benign	0.06
IGL01879:Clstn3	APN	6	124438810	missense	probably damaging	1.00
IGL01998:Clstn3	APN	6	124458663	missense	probably damaging	1.00
IGL03130:Clstn3	APN	6	124459263	missense	probably damaging	0.98
IGL03405:Clstn3	APN	6	124438368	missense	possibly damaging	0.95
PIT4403001:Clstn3	UTSW	6	124458023	missense	probably damaging	1.00
R0049:Clstn3	UTSW	6	124459853	missense	possibly damaging	0.87
R0049:Clstn3	UTSW	6	124459853	missense	possibly damaging	0.87
R0208:Clstn3	UTSW	6	124432169	splice site	probably benign
R0276:Clstn3	UTSW	6	124431740	splice site	probably benign
R0440:Clstn3	UTSW	6	124451413	missense	probably damaging	1.00
R0612:Clstn3	UTSW	6	124449500	missense	probably damaging	0.98
R1200:Clstn3	UTSW	6	124459170	missense	probably damaging	1.00
R1224:Clstn3	UTSW	6	124457919	missense	probably benign
R1378:Clstn3	UTSW	6	124438419	missense	probably damaging	1.00
R1491:Clstn3	UTSW	6	124437490	missense	possibly damaging	0.51
R1495:Clstn3	UTSW	6	124449917	missense	probably benign	0.00
R1511:Clstn3	UTSW	6	124462169	missense	probably damaging	1.00
R1655:Clstn3	UTSW	6	124437427	missense	probably damaging	1.00
R1731:Clstn3	UTSW	6	124431632	missense	probably benign	0.04
R1734:Clstn3	UTSW	6	124436814	splice site	probably benign
R1751:Clstn3	UTSW	6	124431999	missense	probably damaging	1.00
R1954:Clstn3	UTSW	6	124459298	missense	possibly damaging	0.94
R2133:Clstn3	UTSW	6	124449503	missense	probably benign
R2192:Clstn3	UTSW	6	124459207	missense	probably damaging	1.00
R2314:Clstn3	UTSW	6	124450717	missense	probably benign	0.39
R2874:Clstn3	UTSW	6	124438335	missense	probably damaging	1.00
R3500:Clstn3	UTSW	6	124431711	missense	probably benign	0.01
R3761:Clstn3	UTSW	6	124457876	missense	possibly damaging	0.54
R3878:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R3927:Clstn3	UTSW	6	124451368	missense	probably damaging	1.00
R3935:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R4063:Clstn3	UTSW	6	124449833	missense	possibly damaging	0.51
R4402:Clstn3	UTSW	6	124456980	missense	probably damaging	0.96
R4534:Clstn3	UTSW	6	124459220	missense	probably damaging	1.00
R4785:Clstn3	UTSW	6	124437372	splice site	probably null
R4834:Clstn3	UTSW	6	124431953	splice site	probably null
R5921:Clstn3	UTSW	6	124431580	utr 3 prime	probably benign
R5932:Clstn3	UTSW	6	124438332	missense	probably benign	0.01
R6025:Clstn3	UTSW	6	124431664	missense	possibly damaging	0.73
R6101:Clstn3	UTSW	6	124461670	missense	probably damaging	1.00
R6360:Clstn3	UTSW	6	124438429	missense	possibly damaging	0.88
R6578:Clstn3	UTSW	6	124450704	critical splice donor site	probably null
R6813:Clstn3	UTSW	6	124436935	missense	probably benign	0.00
R7380:Clstn3	UTSW	6	124456989	missense	probably benign	0.01
R7419:Clstn3	UTSW	6	124458129	missense	probably benign	0.05
R7625:Clstn3	UTSW	6	124437418	nonsense	probably null
R7780:Clstn3	UTSW	6	124462202	missense	probably damaging	0.98
R7936:Clstn3	UTSW	6	124432013	missense	possibly damaging	0.73
R7939:Clstn3	UTSW	6	124462199	missense	probably damaging	1.00
R8047:Clstn3	UTSW	6	124432013	missense	possibly damaging	0.73
R8079:Clstn3	UTSW	6	124459804	missense	probably damaging	1.00
R8085:Clstn3	UTSW	6	124458724	missense	probably benign	0.23
R8299:Clstn3	UTSW	6	124437373	critical splice donor site	probably null
R8406:Clstn3	UTSW	6	124462177	missense	probably damaging	1.00
RF014:Clstn3	UTSW	6	124459266	nonsense	probably null
X0066:Clstn3	UTSW	6	124449811	missense	probably benign	0.13
Z1176:Clstn3	UTSW	6	124459200	missense	probably damaging	1.00
Z1177:Clstn3	UTSW	6	124449781	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCTGCCAACAGTACTTATTGGG -3'
(R):5'- AGAGGAGATGAATTGTTTCCTTTCC -3'

Sequencing Primer
(F):5'- CCAACAGTACTTATTGGGTAACGGC -3'
(R):5'- CCTTTGGGGCATCTGCAG -3'

Posted On

2015-04-17