Mutagenetix > Incidental Mutation

Incidental Mutation 'R0375:Dhx38'

30694

Institutional Source

Beutler Lab

Gene Symbol

Dhx38

Ensembl Gene

ENSMUSG00000037993

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 38

Synonyms

5730550P09Rik, Ddx38, Prp16

MMRRC Submission

038581-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R0375 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109548011-109565861 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 109555181 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 735 (V735A)

Ref Sequence

ENSEMBL: ENSMUSP00000047865 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042601]

AlphaFold

Q80X98

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042601
AA Change: V735A

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000047865
Gene: ENSMUSG00000037993
AA Change: V735A

Domain	Start	End	E-Value	Type
Blast:DEXDc	3	146	2e-46	BLAST
low complexity region	147	204	N/A	INTRINSIC
Blast:DEXDc	205	444	1e-105	BLAST
low complexity region	511	525	N/A	INTRINSIC
DEXDc	531	715	6.88e-34	SMART
HELICc	759	862	1.11e-19	SMART
HA2	923	1013	3.22e-32	SMART
low complexity region	1163	1194	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212667

Meta Mutation Damage Score

0.5162

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD/H box family of splicing factors. This protein resembles yeast Prp16 more closely than other DEAD/H family members. It is an ATPase and essential for the catalytic step II in pre-mRNA splicing process. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,046,252	T4707I	probably damaging	Het
5730522E02Rik	T	A	11: 25,769,092	Y17F	unknown	Het
Aars2	A	G	17: 45,514,550	D313G	probably damaging	Het
Abca9	A	T	11: 110,115,447	D1277E	probably benign	Het
Adgrl1	G	T	8: 83,934,901	A981S	probably damaging	Het
Aff3	T	G	1: 38,204,940	K917Q	possibly damaging	Het
BC049715	A	T	6: 136,839,996	H78L	probably benign	Het
Cacna1g	C	A	11: 94,411,054	A2027S	possibly damaging	Het
Camk1g	G	A	1: 193,356,401		probably benign	Het
Carf	T	C	1: 60,144,002	V386A	probably damaging	Het
Cd46	A	G	1: 195,086,164	S82P	probably benign	Het
Clic5	A	G	17: 44,270,623	E180G	possibly damaging	Het
Col27a1	A	G	4: 63,225,661	T529A	probably benign	Het
Col7a1	C	T	9: 108,980,237	R2627C	unknown	Het
Cuzd1	G	A	7: 131,311,908		probably benign	Het
Cwc27	T	C	13: 104,807,823	D50G	possibly damaging	Het
Dhx57	T	G	17: 80,258,121	E834A	probably damaging	Het
Dsg4	A	G	18: 20,470,879	D801G	probably damaging	Het
Dtx1	T	C	5: 120,681,399	E578G	probably damaging	Het
F830016B08Rik	A	T	18: 60,300,193	H116L	probably damaging	Het
Fam208b	A	G	13: 3,596,842	V61A	possibly damaging	Het
Fbxw18	T	C	9: 109,688,839	I360V	possibly damaging	Het
Fignl2	G	A	15: 101,054,093	P103S	probably benign	Het
Frmpd1	A	G	4: 45,284,196	T1006A	probably benign	Het
Ggnbp2	G	T	11: 84,836,374	C545*	probably null	Het
Gm3336	A	G	8: 70,718,645		probably benign	Het
Gpr37	T	C	6: 25,669,291	N518S	probably benign	Het
Hbs1l	T	A	10: 21,342,541	D312E	possibly damaging	Het
Hoxd10	C	A	2: 74,692,720	S247R	probably benign	Het
Ifnb1	A	T	4: 88,522,744	F11I	probably benign	Het
Marf1	T	C	16: 14,151,320		probably benign	Het
Myo1f	T	A	17: 33,601,956	V879E	probably benign	Het
Naip1	A	G	13: 100,409,148	F1291L	probably benign	Het
Nckap1l	A	G	15: 103,474,159	E529G	probably damaging	Het
Npm3	T	C	19: 45,748,229	E157G	probably damaging	Het
Olfr1200	T	A	2: 88,767,641	T225S	possibly damaging	Het
Olfr1240	G	T	2: 89,439,396	N294K	probably benign	Het
Olfr248	A	G	1: 174,391,209	T47A	probably damaging	Het
Pex16	G	A	2: 92,380,457	G312D	probably damaging	Het
Ppp6r1	A	G	7: 4,633,287	V768A	probably benign	Het
Prrc1	A	G	18: 57,362,492	T14A	probably damaging	Het
Ranbp2	T	C	10: 58,477,283	L1275P	probably damaging	Het
Rnf214	C	A	9: 45,899,823	V181F	probably damaging	Het
Ror2	T	C	13: 53,132,004	N58S	probably damaging	Het
Selplg	G	A	5: 113,820,008	T79I	probably damaging	Het
Setd1b	G	A	5: 123,157,437	G1023S	unknown	Het
Sf3b2	C	T	19: 5,274,824	D845N	probably damaging	Het
Skint5	A	G	4: 113,705,596	V803A	unknown	Het
Slc25a46	T	C	18: 31,583,266	I394M	possibly damaging	Het
Snrnp27	A	T	6: 86,680,953	I101K	possibly damaging	Het
Spag17	C	A	3: 100,027,590	T704K	probably benign	Het
Tas2r144	T	A	6: 42,216,124	M266K	possibly damaging	Het
Tbc1d31	T	A	15: 57,955,350	L783H	probably benign	Het
Tbck	C	A	3: 132,751,232		probably benign	Het
Vcan	A	G	13: 89,691,275	V2050A	probably damaging	Het
Vmn1r70	T	A	7: 10,634,060	N158K	probably damaging	Het
Vmn2r103	T	A	17: 19,792,859	Y81N	probably benign	Het
Vmn2r103	A	G	17: 19,793,464	T173A	probably benign	Het
Ylpm1	T	G	12: 85,014,980	S552A	unknown	Het
Zdhhc17	A	T	10: 110,982,106	Y58*	probably null	Het

Other mutations in Dhx38

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Dhx38	APN	8	109556934	missense	possibly damaging	0.49
IGL00821:Dhx38	APN	8	109555654	missense	probably benign	0.00
IGL00910:Dhx38	APN	8	109559034	missense	probably benign	0.07
IGL01011:Dhx38	APN	8	109562691	missense	probably benign
IGL01401:Dhx38	APN	8	109552114	missense	probably benign	0.15
IGL02133:Dhx38	APN	8	109558241	nonsense	probably null
IGL02529:Dhx38	APN	8	109559013	missense	probably benign	0.00
IGL02652:Dhx38	APN	8	109556129	missense	probably damaging	1.00
IGL03241:Dhx38	APN	8	109562656	missense	possibly damaging	0.47
IGL03378:Dhx38	APN	8	109559090	splice site	probably null
R0358:Dhx38	UTSW	8	109552462	missense	probably benign	0.13
R0437:Dhx38	UTSW	8	109558629	splice site	probably benign
R0481:Dhx38	UTSW	8	109556216	splice site	probably benign
R0492:Dhx38	UTSW	8	109561944	splice site	probably benign
R0528:Dhx38	UTSW	8	109562661	missense	probably benign	0.00
R0607:Dhx38	UTSW	8	109558943	missense	probably benign	0.07
R1638:Dhx38	UTSW	8	109553545	missense	probably damaging	1.00
R2020:Dhx38	UTSW	8	109556869	splice site	probably benign
R2056:Dhx38	UTSW	8	109562720	unclassified	probably benign
R2096:Dhx38	UTSW	8	109554259	missense	probably damaging	1.00
R2152:Dhx38	UTSW	8	109560674	missense	probably benign	0.00
R2154:Dhx38	UTSW	8	109560674	missense	probably benign	0.00
R2382:Dhx38	UTSW	8	109556140	missense	probably damaging	0.99
R4367:Dhx38	UTSW	8	109553131	missense	probably damaging	1.00
R4368:Dhx38	UTSW	8	109553131	missense	probably damaging	1.00
R4369:Dhx38	UTSW	8	109553131	missense	probably damaging	1.00
R5250:Dhx38	UTSW	8	109556520	missense	probably damaging	1.00
R5354:Dhx38	UTSW	8	109555746	missense	probably damaging	1.00
R5668:Dhx38	UTSW	8	109553416	missense	probably damaging	1.00
R5777:Dhx38	UTSW	8	109556902	missense	possibly damaging	0.81
R5784:Dhx38	UTSW	8	109559613	nonsense	probably null
R6799:Dhx38	UTSW	8	109553202	missense	probably damaging	1.00
R6915:Dhx38	UTSW	8	109559599	missense	probably benign	0.15
R6932:Dhx38	UTSW	8	109552675	missense	probably damaging	1.00
R7042:Dhx38	UTSW	8	109556985	missense	possibly damaging	0.55
R7248:Dhx38	UTSW	8	109558927	missense	probably benign	0.15
R7394:Dhx38	UTSW	8	109556523	missense	probably damaging	1.00
R7513:Dhx38	UTSW	8	109560589	missense	probably benign	0.00
R7569:Dhx38	UTSW	8	109560695	missense	probably damaging	0.98
R8003:Dhx38	UTSW	8	109556140	missense	probably damaging	0.99
R8071:Dhx38	UTSW	8	109558701	missense	probably benign	0.10
R8537:Dhx38	UTSW	8	109553380	missense	probably damaging	1.00
R8852:Dhx38	UTSW	8	109562729	nonsense	probably null
R8860:Dhx38	UTSW	8	109562729	nonsense	probably null
R8937:Dhx38	UTSW	8	109556466	missense	probably damaging	0.96
R9099:Dhx38	UTSW	8	109556151	missense	probably damaging	1.00
Z1177:Dhx38	UTSW	8	109556085	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGAAAAGCCCAGTTCACACCTGTTC -3'
(R):5'- TGACGCCAGCCTCAAGGATTTG -3'

Sequencing Primer
(F):5'- GGAAAGAAATATCCCCCCTCTTG -3'
(R):5'- TTGTCTCTGAAGCAAGGAGCC -3'

Posted On

2013-04-24