Incidental Mutation 'R3934:Fgfr1op2'
ID 306941
Institutional Source Beutler Lab
Gene Symbol Fgfr1op2
Ensembl Gene ENSMUSG00000040242
Gene Name FGFR1 oncogene partner 2
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.556) question?
Stock # R3934 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 146577203-146599198 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 146595171 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037836] [ENSMUST00000058245] [ENSMUST00000067404] [ENSMUST00000111663]
AlphaFold Q9CRA9
Predicted Effect probably benign
Transcript: ENSMUST00000037836
SMART Domains Protein: ENSMUSP00000037316
Gene: ENSMUSG00000040242

DomainStartEndE-ValueType
Pfam:DUF837 1 142 4e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058245
SMART Domains Protein: ENSMUSP00000107289
Gene: ENSMUSG00000040242

DomainStartEndE-ValueType
Pfam:DUF837 1 142 4e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067404
SMART Domains Protein: ENSMUSP00000098352
Gene: ENSMUSG00000040242

DomainStartEndE-ValueType
Pfam:DUF837 1 185 8.6e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111663
SMART Domains Protein: ENSMUSP00000107292
Gene: ENSMUSG00000040242

DomainStartEndE-ValueType
Pfam:DUF837 2 221 2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160697
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik T A 12: 18,534,081 Y381N possibly damaging Het
Adgrf3 T C 5: 30,200,434 probably benign Het
Adgrv1 A G 13: 81,475,047 F3819S probably benign Het
Aig1 T C 10: 13,801,912 D112G probably damaging Het
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
C2cd5 C T 6: 143,041,380 V499I possibly damaging Het
Capn11 A T 17: 45,634,287 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Enpp2 A G 15: 54,845,921 V766A probably benign Het
Fastk G T 5: 24,442,259 S317* probably null Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hectd4 G A 5: 121,320,101 probably null Het
Hmcn2 T A 2: 31,380,484 probably null Het
Hspbp1 A T 7: 4,664,595 M271K probably benign Het
Itgb6 G A 2: 60,611,411 T685M possibly damaging Het
Itih5 G A 2: 10,245,544 V685I probably damaging Het
Kalrn T C 16: 34,310,531 S421G probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Perm1 A G 4: 156,219,170 T724A probably benign Het
Pex5l T C 3: 33,007,172 E176G probably damaging Het
Polk A T 13: 96,501,635 M192K possibly damaging Het
Polr3a T C 14: 24,476,101 I401V probably benign Het
Prpf38b T C 3: 108,904,425 probably benign Het
Sema3c T C 5: 17,681,940 S330P probably damaging Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc39a12 T A 2: 14,434,363 probably benign Het
Sod3 T C 5: 52,368,645 S229P probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Spink5 G T 18: 44,016,427 K958N probably damaging Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ush2a T A 1: 188,263,511 probably null Het
Vmn2r19 T A 6: 123,315,669 D223E probably damaging Het
Vwf T A 6: 125,555,499 S87T probably damaging Het
Wdr35 G T 12: 9,008,014 G513C probably damaging Het
Other mutations in Fgfr1op2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02591:Fgfr1op2 APN 6 146588846 missense probably damaging 0.97
IGL02626:Fgfr1op2 APN 6 146590011 missense probably benign 0.37
IGL03081:Fgfr1op2 APN 6 146597319 missense probably damaging 0.98
R1381:Fgfr1op2 UTSW 6 146588741 missense probably damaging 1.00
R3740:Fgfr1op2 UTSW 6 146595233 missense possibly damaging 0.94
R5471:Fgfr1op2 UTSW 6 146597362 splice site probably null
R6842:Fgfr1op2 UTSW 6 146590038 critical splice donor site probably null
R6988:Fgfr1op2 UTSW 6 146589965 missense probably damaging 0.99
R9201:Fgfr1op2 UTSW 6 146592719 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCACGCAGACTTCAGGGAAG -3'
(R):5'- CCACCAACTTAAAGAGTGTGGG -3'

Sequencing Primer
(F):5'- CCCTTTTACCACAGTACATGTAGATG -3'
(R):5'- CCAACTTAAAGAGTGTGGGTGTTAAG -3'
Posted On 2015-04-17