Incidental Mutation 'R3934:Hspbp1'
ID306942
Institutional Source Beutler Lab
Gene Symbol Hspbp1
Ensembl Gene ENSMUSG00000063802
Gene NameHSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R3934 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4660521-4685068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4664595 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 271 (M271K)
Ref Sequence ENSEMBL: ENSMUSP00000078886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079970] [ENSMUST00000205952]
Predicted Effect probably benign
Transcript: ENSMUST00000079970
AA Change: M271K

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078886
Gene: ENSMUSG00000063802
AA Change: M271K

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
Pfam:Fes1 43 138 2.5e-12 PFAM
SCOP:d1ee4a_ 150 302 2e-12 SMART
Blast:ARM 216 256 3e-11 BLAST
Blast:ARM 259 299 4e-13 BLAST
low complexity region 306 342 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000205474
AA Change: M3K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205812
Predicted Effect probably benign
Transcript: ENSMUST00000205952
AA Change: M271K

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206708
Meta Mutation Damage Score 0.1033 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation show male infertility with an arrest of male meiosis, increased male germ cell apoptosis and azoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik T A 12: 18,534,081 Y381N possibly damaging Het
Adgrf3 T C 5: 30,200,434 probably benign Het
Adgrv1 A G 13: 81,475,047 F3819S probably benign Het
Aig1 T C 10: 13,801,912 D112G probably damaging Het
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
C2cd5 C T 6: 143,041,380 V499I possibly damaging Het
Capn11 A T 17: 45,634,287 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Enpp2 A G 15: 54,845,921 V766A probably benign Het
Fastk G T 5: 24,442,259 S317* probably null Het
Fgfr1op2 T A 6: 146,595,171 probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hectd4 G A 5: 121,320,101 probably null Het
Hmcn2 T A 2: 31,380,484 probably null Het
Itgb6 G A 2: 60,611,411 T685M possibly damaging Het
Itih5 G A 2: 10,245,544 V685I probably damaging Het
Kalrn T C 16: 34,310,531 S421G probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Perm1 A G 4: 156,219,170 T724A probably benign Het
Pex5l T C 3: 33,007,172 E176G probably damaging Het
Polk A T 13: 96,501,635 M192K possibly damaging Het
Polr3a T C 14: 24,476,101 I401V probably benign Het
Prpf38b T C 3: 108,904,425 probably benign Het
Sema3c T C 5: 17,681,940 S330P probably damaging Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc39a12 T A 2: 14,434,363 probably benign Het
Sod3 T C 5: 52,368,645 S229P probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Spink5 G T 18: 44,016,427 K958N probably damaging Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ush2a T A 1: 188,263,511 probably null Het
Vmn2r19 T A 6: 123,315,669 D223E probably damaging Het
Vwf T A 6: 125,555,499 S87T probably damaging Het
Wdr35 G T 12: 9,008,014 G513C probably damaging Het
Other mutations in Hspbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Hspbp1 APN 7 4664751 missense probably damaging 0.97
IGL02072:Hspbp1 APN 7 4677721 missense probably damaging 1.00
IGL02548:Hspbp1 APN 7 4681841 splice site probably benign
IGL02573:Hspbp1 APN 7 4677853 missense probably damaging 1.00
IGL03177:Hspbp1 APN 7 4664701 critical splice donor site probably null
IGL03181:Hspbp1 APN 7 4684364 missense probably damaging 1.00
R0568:Hspbp1 UTSW 7 4684432 nonsense probably null
R0670:Hspbp1 UTSW 7 4677736 missense probably damaging 1.00
R3013:Hspbp1 UTSW 7 4663484 missense probably benign 0.18
R3729:Hspbp1 UTSW 7 4677809 missense probably damaging 1.00
R6031:Hspbp1 UTSW 7 4663466 missense probably benign 0.28
R6031:Hspbp1 UTSW 7 4663466 missense probably benign 0.28
R6034:Hspbp1 UTSW 7 4677712 missense probably damaging 1.00
R6034:Hspbp1 UTSW 7 4677712 missense probably damaging 1.00
R6728:Hspbp1 UTSW 7 4660782 missense possibly damaging 0.93
R6797:Hspbp1 UTSW 7 4660782 missense possibly damaging 0.93
R6930:Hspbp1 UTSW 7 4684607 missense probably benign
R6992:Hspbp1 UTSW 7 4664715 missense probably benign 0.23
R7459:Hspbp1 UTSW 7 4684578 missense probably benign 0.00
R7525:Hspbp1 UTSW 7 4663436 missense probably damaging 1.00
R7608:Hspbp1 UTSW 7 4660822 missense possibly damaging 0.73
R7962:Hspbp1 UTSW 7 4681842 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGGGATAGTTCCAGTGCAGG -3'
(R):5'- GATTCTCAGTGCTGATGCGG -3'

Sequencing Primer
(F):5'- ATAGTTCCAGTGCAGGGTCCC -3'
(R):5'- GCAAGTGCAGAAGCTCAAGGTC -3'
Posted On2015-04-17