Incidental Mutation 'R3934:Aig1'
ID 306944
Institutional Source Beutler Lab
Gene Symbol Aig1
Ensembl Gene ENSMUSG00000019806
Gene Name androgen-induced 1
Synonyms 1500031O19Rik, CGI-103
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3934 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 13647054-13868980 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13801912 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 112 (D112G)
Ref Sequence ENSEMBL: ENSMUSP00000125366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019942] [ENSMUST00000105534] [ENSMUST00000162610]
AlphaFold Q9D8B1
Predicted Effect probably damaging
Transcript: ENSMUST00000019942
AA Change: D112G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019942
Gene: ENSMUSG00000019806
AA Change: D112G

DomainStartEndE-ValueType
Pfam:Far-17a_AIG1 12 219 5.6e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105534
AA Change: D112G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101174
Gene: ENSMUSG00000019806
AA Change: D112G

DomainStartEndE-ValueType
Pfam:Far-17a_AIG1 12 178 3.4e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162174
Predicted Effect probably damaging
Transcript: ENSMUST00000162610
AA Change: D112G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125366
Gene: ENSMUSG00000019806
AA Change: D112G

DomainStartEndE-ValueType
Pfam:Far-17a_AIG1 12 219 5.4e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162798
Meta Mutation Damage Score 0.9298 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik T A 12: 18,534,081 Y381N possibly damaging Het
Adgrf3 T C 5: 30,200,434 probably benign Het
Adgrv1 A G 13: 81,475,047 F3819S probably benign Het
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
C2cd5 C T 6: 143,041,380 V499I possibly damaging Het
Capn11 A T 17: 45,634,287 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Enpp2 A G 15: 54,845,921 V766A probably benign Het
Fastk G T 5: 24,442,259 S317* probably null Het
Fgfr1op2 T A 6: 146,595,171 probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hectd4 G A 5: 121,320,101 probably null Het
Hmcn2 T A 2: 31,380,484 probably null Het
Hspbp1 A T 7: 4,664,595 M271K probably benign Het
Itgb6 G A 2: 60,611,411 T685M possibly damaging Het
Itih5 G A 2: 10,245,544 V685I probably damaging Het
Kalrn T C 16: 34,310,531 S421G probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Perm1 A G 4: 156,219,170 T724A probably benign Het
Pex5l T C 3: 33,007,172 E176G probably damaging Het
Polk A T 13: 96,501,635 M192K possibly damaging Het
Polr3a T C 14: 24,476,101 I401V probably benign Het
Prpf38b T C 3: 108,904,425 probably benign Het
Sema3c T C 5: 17,681,940 S330P probably damaging Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc39a12 T A 2: 14,434,363 probably benign Het
Sod3 T C 5: 52,368,645 S229P probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Spink5 G T 18: 44,016,427 K958N probably damaging Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ush2a T A 1: 188,263,511 probably null Het
Vmn2r19 T A 6: 123,315,669 D223E probably damaging Het
Vwf T A 6: 125,555,499 S87T probably damaging Het
Wdr35 G T 12: 9,008,014 G513C probably damaging Het
Other mutations in Aig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02343:Aig1 APN 10 13868674 missense probably damaging 0.99
IGL02715:Aig1 APN 10 13868616 critical splice donor site probably null
R0697:Aig1 UTSW 10 13829325 missense probably benign 0.01
R1699:Aig1 UTSW 10 13868622 missense possibly damaging 0.85
R1761:Aig1 UTSW 10 13690584 missense probably damaging 1.00
R4397:Aig1 UTSW 10 13652982 missense probably benign 0.00
R4736:Aig1 UTSW 10 13801930 missense probably damaging 0.97
R4767:Aig1 UTSW 10 13801858 missense probably damaging 1.00
R5081:Aig1 UTSW 10 13801900 missense probably benign 0.01
R5907:Aig1 UTSW 10 13801784 intron probably benign
R7944:Aig1 UTSW 10 13868673 missense probably damaging 1.00
R9105:Aig1 UTSW 10 13653595 missense probably benign 0.10
R9270:Aig1 UTSW 10 13653761 splice site probably null
R9381:Aig1 UTSW 10 13647673 missense probably benign 0.39
X0018:Aig1 UTSW 10 13690524 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAATGGCTCGGTTCCACAG -3'
(R):5'- GCAGCTGCTACTATAGAGCAAC -3'

Sequencing Primer
(F):5'- GGTTCCACAGGACAAATCTCATTTAC -3'
(R):5'- TCCAAGCTCTCTTGGGTT -3'
Posted On 2015-04-17