Incidental Mutation 'R3934:Wdr35'
ID306948
Institutional Source Beutler Lab
Gene Symbol Wdr35
Ensembl Gene ENSMUSG00000066643
Gene NameWD repeat domain 35
Synonyms4930459M12Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3934 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location8973892-9028847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 9008014 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 513 (G513C)
Ref Sequence ENSEMBL: ENSMUSP00000106742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085745] [ENSMUST00000111113]
Predicted Effect probably damaging
Transcript: ENSMUST00000085745
AA Change: G524C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643
AA Change: G524C

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111113
AA Change: G513C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643
AA Change: G513C

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161019
Meta Mutation Damage Score 0.9076 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit mid-gestation lethality, heart development defects, turning defects, polysyndactyly, hypoplastic lungs, tracheoesophageal fistula, herniated diaphragm and absent embryonic cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik T A 12: 18,534,081 Y381N possibly damaging Het
Adgrf3 T C 5: 30,200,434 probably benign Het
Adgrv1 A G 13: 81,475,047 F3819S probably benign Het
Aig1 T C 10: 13,801,912 D112G probably damaging Het
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
C2cd5 C T 6: 143,041,380 V499I possibly damaging Het
Capn11 A T 17: 45,634,287 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Enpp2 A G 15: 54,845,921 V766A probably benign Het
Fastk G T 5: 24,442,259 S317* probably null Het
Fgfr1op2 T A 6: 146,595,171 probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hectd4 G A 5: 121,320,101 probably null Het
Hmcn2 T A 2: 31,380,484 probably null Het
Hspbp1 A T 7: 4,664,595 M271K probably benign Het
Itgb6 G A 2: 60,611,411 T685M possibly damaging Het
Itih5 G A 2: 10,245,544 V685I probably damaging Het
Kalrn T C 16: 34,310,531 S421G probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Perm1 A G 4: 156,219,170 T724A probably benign Het
Pex5l T C 3: 33,007,172 E176G probably damaging Het
Polk A T 13: 96,501,635 M192K possibly damaging Het
Polr3a T C 14: 24,476,101 I401V probably benign Het
Prpf38b T C 3: 108,904,425 probably benign Het
Sema3c T C 5: 17,681,940 S330P probably damaging Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc39a12 T A 2: 14,434,363 probably benign Het
Sod3 T C 5: 52,368,645 S229P probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Spink5 G T 18: 44,016,427 K958N probably damaging Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ush2a T A 1: 188,263,511 probably null Het
Vmn2r19 T A 6: 123,315,669 D223E probably damaging Het
Vwf T A 6: 125,555,499 S87T probably damaging Het
Other mutations in Wdr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Wdr35 APN 12 9019900 missense probably benign
IGL00962:Wdr35 APN 12 9021726 splice site probably benign
IGL01094:Wdr35 APN 12 9005838 splice site probably benign
IGL01312:Wdr35 APN 12 9008655 missense probably damaging 1.00
IGL01397:Wdr35 APN 12 9008550 missense probably benign 0.04
IGL01490:Wdr35 APN 12 8977381 missense probably damaging 0.98
IGL02153:Wdr35 APN 12 9008535 missense probably null 0.04
IGL02319:Wdr35 APN 12 9027480 unclassified probably benign
IGL02548:Wdr35 APN 12 9024297 missense probably benign 0.00
IGL02941:Wdr35 APN 12 9027507 missense probably damaging 0.98
IGL03038:Wdr35 APN 12 8974185 splice site probably benign
IGL03086:Wdr35 APN 12 9008692 splice site probably null
IGL03207:Wdr35 APN 12 8989936 missense probably damaging 0.98
IGL03327:Wdr35 APN 12 8978694 splice site probably benign
R0362:Wdr35 UTSW 12 8995625 unclassified probably benign
R0464:Wdr35 UTSW 12 9027472 unclassified probably benign
R0487:Wdr35 UTSW 12 9012743 critical splice donor site probably null
R0976:Wdr35 UTSW 12 8986104 missense probably benign 0.03
R1349:Wdr35 UTSW 12 9019870 splice site probably benign
R1663:Wdr35 UTSW 12 9020000 missense probably benign 0.00
R1769:Wdr35 UTSW 12 9012728 missense probably damaging 1.00
R1779:Wdr35 UTSW 12 8985772 missense possibly damaging 0.62
R1789:Wdr35 UTSW 12 8977435 critical splice donor site probably null
R1893:Wdr35 UTSW 12 8985994 missense probably benign
R2076:Wdr35 UTSW 12 9024281 missense possibly damaging 0.88
R2228:Wdr35 UTSW 12 8974955 missense possibly damaging 0.65
R2280:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2281:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2863:Wdr35 UTSW 12 9028060 nonsense probably null
R3713:Wdr35 UTSW 12 9027648 missense possibly damaging 0.68
R3911:Wdr35 UTSW 12 8986077 missense probably benign
R4360:Wdr35 UTSW 12 8974149 utr 5 prime probably benign
R4402:Wdr35 UTSW 12 8989981 missense probably damaging 0.98
R4473:Wdr35 UTSW 12 9015995 missense probably benign 0.00
R4656:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R4780:Wdr35 UTSW 12 9018150 missense probably benign
R5092:Wdr35 UTSW 12 8987327 missense probably damaging 1.00
R5160:Wdr35 UTSW 12 9008487 missense probably damaging 0.99
R5184:Wdr35 UTSW 12 9018142 missense probably damaging 1.00
R5346:Wdr35 UTSW 12 8978684 missense probably benign 0.00
R5435:Wdr35 UTSW 12 8989951 missense probably benign 0.01
R5472:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R5682:Wdr35 UTSW 12 8981125 missense probably damaging 1.00
R5801:Wdr35 UTSW 12 9006723 missense possibly damaging 0.92
R5990:Wdr35 UTSW 12 9016511 missense probably damaging 1.00
R6196:Wdr35 UTSW 12 9027632 missense probably benign 0.05
R6531:Wdr35 UTSW 12 8978685 missense probably benign 0.00
R6746:Wdr35 UTSW 12 9003982 splice site probably null
R6816:Wdr35 UTSW 12 9027724 critical splice donor site probably null
R6863:Wdr35 UTSW 12 8990047 missense probably damaging 0.97
R7088:Wdr35 UTSW 12 8978659 missense probably benign 0.11
R7140:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7327:Wdr35 UTSW 12 8987312 missense probably benign 0.10
R7403:Wdr35 UTSW 12 9012685 missense probably damaging 0.98
R7422:Wdr35 UTSW 12 9004105 missense probably benign 0.00
R7438:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7466:Wdr35 UTSW 12 9005773 missense probably benign
R7491:Wdr35 UTSW 12 8986000 missense probably benign 0.00
R7599:Wdr35 UTSW 12 9024886 missense probably benign 0.01
R7620:Wdr35 UTSW 12 9016042 missense probably benign 0.04
R7857:Wdr35 UTSW 12 9008113 critical splice donor site probably null
R7940:Wdr35 UTSW 12 9008113 critical splice donor site probably null
X0066:Wdr35 UTSW 12 8990029 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GACCTAGATCTTCGTCCTGAC -3'
(R):5'- TGCCAGGGTTTCCATTTCAAC -3'

Sequencing Primer
(F):5'- CTGCTGTTAAAAGACTCAAGTTGGG -3'
(R):5'- CAGGGTTTCCATTTCAACAAGTTCAC -3'
Posted On2015-04-17