Incidental Mutation 'R3934:5730507C01Rik'
ID306949
Institutional Source Beutler Lab
Gene Symbol 5730507C01Rik
Ensembl Gene ENSMUSG00000073197
Gene NameRIKEN cDNA 5730507C01 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R3934 (G1)
Quality Score183
Status Not validated
Chromosome12
Chromosomal Location18514510-18535254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18534081 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 381 (Y381N)
Ref Sequence ENSEMBL: ENSMUSP00000137525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063216] [ENSMUST00000177778]
Predicted Effect probably benign
Transcript: ENSMUST00000063216
AA Change: Y357N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000099112
Gene: ENSMUSG00000073197
AA Change: Y357N

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
KRAB 45 107 1.74e-14 SMART
ZnF_C2H2 144 166 5.54e1 SMART
ZnF_C2H2 172 194 8.75e0 SMART
ZnF_C2H2 200 222 2.43e-4 SMART
ZnF_C2H2 228 250 2.02e-1 SMART
ZnF_C2H2 256 278 1.4e-4 SMART
ZnF_C2H2 284 306 1.84e-4 SMART
ZnF_C2H2 312 334 6.88e-4 SMART
ZnF_C2H2 340 362 9.58e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177778
AA Change: Y381N

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137525
Gene: ENSMUSG00000073197
AA Change: Y381N

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
KRAB 69 131 1.74e-14 SMART
ZnF_C2H2 168 190 5.54e1 SMART
ZnF_C2H2 196 218 8.75e0 SMART
ZnF_C2H2 224 246 2.43e-4 SMART
ZnF_C2H2 252 274 2.02e-1 SMART
ZnF_C2H2 280 302 1.4e-4 SMART
ZnF_C2H2 308 330 1.84e-4 SMART
ZnF_C2H2 336 358 6.88e-4 SMART
ZnF_C2H2 364 386 9.58e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,200,434 probably benign Het
Adgrv1 A G 13: 81,475,047 F3819S probably benign Het
Aig1 T C 10: 13,801,912 D112G probably damaging Het
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
C2cd5 C T 6: 143,041,380 V499I possibly damaging Het
Capn11 A T 17: 45,634,287 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Enpp2 A G 15: 54,845,921 V766A probably benign Het
Fastk G T 5: 24,442,259 S317* probably null Het
Fgfr1op2 T A 6: 146,595,171 probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hectd4 G A 5: 121,320,101 probably null Het
Hmcn2 T A 2: 31,380,484 probably null Het
Hspbp1 A T 7: 4,664,595 M271K probably benign Het
Itgb6 G A 2: 60,611,411 T685M possibly damaging Het
Itih5 G A 2: 10,245,544 V685I probably damaging Het
Kalrn T C 16: 34,310,531 S421G probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Perm1 A G 4: 156,219,170 T724A probably benign Het
Pex5l T C 3: 33,007,172 E176G probably damaging Het
Polk A T 13: 96,501,635 M192K possibly damaging Het
Polr3a T C 14: 24,476,101 I401V probably benign Het
Prpf38b T C 3: 108,904,425 probably benign Het
Sema3c T C 5: 17,681,940 S330P probably damaging Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc39a12 T A 2: 14,434,363 probably benign Het
Sod3 T C 5: 52,368,645 S229P probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Spink5 G T 18: 44,016,427 K958N probably damaging Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ush2a T A 1: 188,263,511 probably null Het
Vmn2r19 T A 6: 123,315,669 D223E probably damaging Het
Vwf T A 6: 125,555,499 S87T probably damaging Het
Wdr35 G T 12: 9,008,014 G513C probably damaging Het
Other mutations in 5730507C01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:5730507C01Rik APN 12 18533374 missense possibly damaging 0.91
R0419:5730507C01Rik UTSW 12 18533423 missense possibly damaging 0.53
R1662:5730507C01Rik UTSW 12 18531966 missense possibly damaging 0.53
R1851:5730507C01Rik UTSW 12 18533686 missense possibly damaging 0.95
R1902:5730507C01Rik UTSW 12 18534003 nonsense probably null
R2876:5730507C01Rik UTSW 12 18533643 missense possibly damaging 0.60
R3861:5730507C01Rik UTSW 12 18533410 missense probably benign 0.33
R5774:5730507C01Rik UTSW 12 18531667 missense probably damaging 1.00
R6259:5730507C01Rik UTSW 12 18534119 missense probably benign 0.44
R7647:5730507C01Rik UTSW 12 18514802 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTTGCAGAACTCAGTAATCTCCAAC -3'
(R):5'- CGTGACATCAAATGCTTTACAACAC -3'

Sequencing Primer
(F):5'- CGTCATAAAAGAACACATACTGGAG -3'
(R):5'- ACATTCATGAGGTTTCTTTCCAGTG -3'
Posted On2015-04-17