Incidental Mutation 'R3934:Akap6'
ID 306950
Institutional Source Beutler Lab
Gene Symbol Akap6
Ensembl Gene ENSMUSG00000061603
Gene Name A kinase anchor protein 6
Synonyms
Accession Numbers
Essential gene? Probably essential (E-score: 0.776) question?
Stock # R3934 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 52746166-53202382 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 53187227 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1547 (T1547M)
Ref Sequence ENSEMBL: ENSMUSP00000093406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]
AlphaFold E9Q9K8
Predicted Effect possibly damaging
Transcript: ENSMUST00000095737
AA Change: T1547M

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: T1547M

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
Blast:SPEC 66 168 2e-50 BLAST
low complexity region 441 455 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 569 587 N/A INTRINSIC
low complexity region 640 651 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
SPEC 779 880 1.06e-1 SMART
SPEC 959 1057 1.45e0 SMART
SPEC 1078 1185 2.56e-2 SMART
low complexity region 1316 1332 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1610 1622 N/A INTRINSIC
low complexity region 1683 1698 N/A INTRINSIC
low complexity region 1737 1781 N/A INTRINSIC
low complexity region 1899 1910 N/A INTRINSIC
low complexity region 2019 2031 N/A INTRINSIC
low complexity region 2104 2115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219786
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik T A 12: 18,584,082 (GRCm39) Y381N possibly damaging Het
Adgrf3 T C 5: 30,405,432 (GRCm39) probably benign Het
Adgrv1 A G 13: 81,623,166 (GRCm39) F3819S probably benign Het
Aig1 T C 10: 13,677,656 (GRCm39) D112G probably damaging Het
Alk T A 17: 72,512,949 (GRCm39) I337F probably damaging Het
C2cd5 C T 6: 142,987,106 (GRCm39) V499I possibly damaging Het
Capn11 A T 17: 45,945,213 (GRCm39) probably benign Het
Clstn3 G A 6: 124,434,901 (GRCm39) T338I probably damaging Het
Cmbl A G 15: 31,589,933 (GRCm39) D221G possibly damaging Het
Enpp2 A G 15: 54,709,317 (GRCm39) V766A probably benign Het
Fastk G T 5: 24,647,257 (GRCm39) S317* probably null Het
Fgfr1op2 T A 6: 146,496,669 (GRCm39) probably benign Het
Gpr85 A G 6: 13,836,044 (GRCm39) F287L probably benign Het
Hectd4 G A 5: 121,458,164 (GRCm39) probably null Het
Hmcn2 T A 2: 31,270,496 (GRCm39) probably null Het
Hspbp1 A T 7: 4,667,594 (GRCm39) M271K probably benign Het
Itgb6 G A 2: 60,441,755 (GRCm39) T685M possibly damaging Het
Itih5 G A 2: 10,250,355 (GRCm39) V685I probably damaging Het
Kalrn T C 16: 34,130,901 (GRCm39) S421G probably benign Het
Mcm2 G A 6: 88,869,990 (GRCm39) R60C probably damaging Het
Mitf C T 6: 97,970,214 (GRCm39) P54S probably damaging Het
Perm1 A G 4: 156,303,627 (GRCm39) T724A probably benign Het
Pex5l T C 3: 33,061,321 (GRCm39) E176G probably damaging Het
Polk A T 13: 96,638,143 (GRCm39) M192K possibly damaging Het
Polr3a T C 14: 24,526,169 (GRCm39) I401V probably benign Het
Prpf38b T C 3: 108,811,741 (GRCm39) probably benign Het
Sema3c T C 5: 17,886,938 (GRCm39) S330P probably damaging Het
Slc16a7 C A 10: 125,066,712 (GRCm39) R309L probably damaging Het
Slc35f1 C T 10: 52,984,314 (GRCm39) T358I probably damaging Het
Slc39a12 T A 2: 14,439,174 (GRCm39) probably benign Het
Sod3 T C 5: 52,525,987 (GRCm39) S229P probably benign Het
Sorcs3 T A 19: 48,701,943 (GRCm39) V608D probably damaging Het
Spink5 G T 18: 44,149,494 (GRCm39) K958N probably damaging Het
Ttc7 A C 17: 87,678,166 (GRCm39) probably benign Het
Ush2a T A 1: 187,995,708 (GRCm39) probably null Het
Vmn2r19 T A 6: 123,292,628 (GRCm39) D223E probably damaging Het
Vwf T A 6: 125,532,462 (GRCm39) S87T probably damaging Het
Wdr35 G T 12: 9,058,014 (GRCm39) G513C probably damaging Het
Other mutations in Akap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Akap6 APN 12 53,187,763 (GRCm39) missense possibly damaging 0.79
IGL00505:Akap6 APN 12 52,933,885 (GRCm39) missense possibly damaging 0.92
IGL01134:Akap6 APN 12 52,984,000 (GRCm39) missense probably damaging 0.96
IGL01458:Akap6 APN 12 52,933,601 (GRCm39) nonsense probably null
IGL01589:Akap6 APN 12 53,186,447 (GRCm39) missense probably damaging 1.00
IGL01592:Akap6 APN 12 53,188,925 (GRCm39) missense probably damaging 1.00
IGL01738:Akap6 APN 12 52,933,600 (GRCm39) missense probably damaging 0.99
IGL01867:Akap6 APN 12 52,934,791 (GRCm39) missense probably damaging 1.00
IGL02025:Akap6 APN 12 53,187,118 (GRCm39) missense probably benign
IGL02041:Akap6 APN 12 53,187,436 (GRCm39) missense probably damaging 1.00
IGL02058:Akap6 APN 12 53,187,338 (GRCm39) missense probably damaging 1.00
IGL02194:Akap6 APN 12 52,933,606 (GRCm39) missense probably benign 0.00
IGL02226:Akap6 APN 12 53,057,250 (GRCm39) splice site probably benign
IGL02323:Akap6 APN 12 53,187,212 (GRCm39) missense probably benign 0.00
IGL02449:Akap6 APN 12 53,186,971 (GRCm39) missense probably damaging 1.00
IGL02475:Akap6 APN 12 53,186,277 (GRCm39) missense probably benign 0.03
IGL02546:Akap6 APN 12 52,927,521 (GRCm39) missense probably damaging 1.00
IGL02547:Akap6 APN 12 53,187,479 (GRCm39) missense probably damaging 1.00
IGL02588:Akap6 APN 12 52,933,282 (GRCm39) nonsense probably null
IGL02608:Akap6 APN 12 53,057,389 (GRCm39) missense probably benign 0.39
IGL02884:Akap6 APN 12 52,933,405 (GRCm39) missense probably benign 0.00
IGL02945:Akap6 APN 12 52,927,620 (GRCm39) missense probably damaging 1.00
IGL03029:Akap6 APN 12 52,933,195 (GRCm39) missense probably damaging 1.00
IGL03129:Akap6 APN 12 53,187,089 (GRCm39) missense probably damaging 1.00
R0133:Akap6 UTSW 12 53,186,254 (GRCm39) nonsense probably null
R0166:Akap6 UTSW 12 53,187,707 (GRCm39) missense probably benign 0.04
R0189:Akap6 UTSW 12 53,188,037 (GRCm39) missense probably benign 0.41
R0532:Akap6 UTSW 12 52,934,766 (GRCm39) missense probably benign 0.00
R0632:Akap6 UTSW 12 52,983,931 (GRCm39) missense probably damaging 1.00
R0666:Akap6 UTSW 12 52,958,591 (GRCm39) missense probably damaging 1.00
R0723:Akap6 UTSW 12 53,188,685 (GRCm39) missense probably damaging 1.00
R0763:Akap6 UTSW 12 53,188,997 (GRCm39) missense possibly damaging 0.93
R0785:Akap6 UTSW 12 52,933,405 (GRCm39) missense probably benign 0.00
R0879:Akap6 UTSW 12 52,927,582 (GRCm39) missense probably damaging 1.00
R0880:Akap6 UTSW 12 53,186,291 (GRCm39) missense possibly damaging 0.93
R1033:Akap6 UTSW 12 53,116,005 (GRCm39) missense probably damaging 0.97
R1055:Akap6 UTSW 12 52,927,455 (GRCm39) nonsense probably null
R1199:Akap6 UTSW 12 52,842,973 (GRCm39) missense probably damaging 1.00
R1295:Akap6 UTSW 12 52,933,812 (GRCm39) missense probably damaging 1.00
R1389:Akap6 UTSW 12 53,186,303 (GRCm39) missense probably benign 0.15
R1471:Akap6 UTSW 12 53,188,279 (GRCm39) missense probably benign 0.05
R1483:Akap6 UTSW 12 52,842,870 (GRCm39) missense probably damaging 1.00
R1512:Akap6 UTSW 12 52,983,937 (GRCm39) missense probably damaging 1.00
R1648:Akap6 UTSW 12 53,188,789 (GRCm39) nonsense probably null
R1791:Akap6 UTSW 12 53,115,908 (GRCm39) missense probably damaging 1.00
R1888:Akap6 UTSW 12 53,188,958 (GRCm39) missense possibly damaging 0.88
R1888:Akap6 UTSW 12 53,188,958 (GRCm39) missense possibly damaging 0.88
R1891:Akap6 UTSW 12 53,188,958 (GRCm39) missense possibly damaging 0.88
R1899:Akap6 UTSW 12 53,188,635 (GRCm39) missense possibly damaging 0.95
R1917:Akap6 UTSW 12 53,151,395 (GRCm39) missense probably benign 0.13
R1970:Akap6 UTSW 12 52,985,258 (GRCm39) missense probably damaging 0.96
R1987:Akap6 UTSW 12 53,187,578 (GRCm39) missense possibly damaging 0.78
R1988:Akap6 UTSW 12 53,187,578 (GRCm39) missense possibly damaging 0.78
R2153:Akap6 UTSW 12 53,188,187 (GRCm39) missense probably benign 0.03
R2567:Akap6 UTSW 12 52,985,156 (GRCm39) missense probably damaging 1.00
R2568:Akap6 UTSW 12 52,934,061 (GRCm39) missense possibly damaging 0.77
R3025:Akap6 UTSW 12 53,186,926 (GRCm39) missense probably benign
R3051:Akap6 UTSW 12 52,933,816 (GRCm39) missense probably damaging 1.00
R3195:Akap6 UTSW 12 53,119,240 (GRCm39) nonsense probably null
R3196:Akap6 UTSW 12 53,119,240 (GRCm39) nonsense probably null
R3426:Akap6 UTSW 12 52,934,817 (GRCm39) missense probably damaging 1.00
R3783:Akap6 UTSW 12 52,927,552 (GRCm39) missense probably damaging 1.00
R3936:Akap6 UTSW 12 53,187,227 (GRCm39) missense possibly damaging 0.92
R3967:Akap6 UTSW 12 53,188,236 (GRCm39) missense probably damaging 1.00
R3970:Akap6 UTSW 12 53,188,236 (GRCm39) missense probably damaging 1.00
R4042:Akap6 UTSW 12 53,186,162 (GRCm39) critical splice acceptor site probably null
R4095:Akap6 UTSW 12 53,186,245 (GRCm39) missense probably damaging 1.00
R4152:Akap6 UTSW 12 53,187,190 (GRCm39) missense probably benign 0.45
R4231:Akap6 UTSW 12 53,187,821 (GRCm39) missense probably damaging 1.00
R4232:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4233:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4234:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4235:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4236:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4475:Akap6 UTSW 12 53,188,426 (GRCm39) missense probably benign 0.00
R4513:Akap6 UTSW 12 52,842,787 (GRCm39) missense probably benign 0.03
R4686:Akap6 UTSW 12 52,934,406 (GRCm39) frame shift probably null
R4724:Akap6 UTSW 12 52,842,668 (GRCm39) missense possibly damaging 0.80
R4782:Akap6 UTSW 12 52,934,406 (GRCm39) frame shift probably null
R4852:Akap6 UTSW 12 53,151,458 (GRCm39) missense probably damaging 1.00
R5024:Akap6 UTSW 12 53,189,345 (GRCm39) missense probably benign 0.01
R5116:Akap6 UTSW 12 53,188,298 (GRCm39) missense probably benign 0.01
R5164:Akap6 UTSW 12 53,189,249 (GRCm39) missense probably benign
R5225:Akap6 UTSW 12 52,933,329 (GRCm39) missense probably damaging 1.00
R5269:Akap6 UTSW 12 53,186,626 (GRCm39) missense probably damaging 0.99
R5352:Akap6 UTSW 12 52,842,880 (GRCm39) missense probably damaging 1.00
R5496:Akap6 UTSW 12 53,187,436 (GRCm39) missense possibly damaging 0.87
R5551:Akap6 UTSW 12 52,842,747 (GRCm39) missense probably damaging 1.00
R5997:Akap6 UTSW 12 52,984,016 (GRCm39) critical splice donor site probably null
R6137:Akap6 UTSW 12 53,187,137 (GRCm39) missense probably damaging 1.00
R6151:Akap6 UTSW 12 53,072,575 (GRCm39) missense probably damaging 1.00
R6169:Akap6 UTSW 12 53,189,141 (GRCm39) missense probably benign
R6307:Akap6 UTSW 12 53,188,351 (GRCm39) missense possibly damaging 0.85
R6351:Akap6 UTSW 12 53,188,808 (GRCm39) missense probably damaging 0.98
R6479:Akap6 UTSW 12 53,187,952 (GRCm39) missense probably damaging 1.00
R6502:Akap6 UTSW 12 53,186,998 (GRCm39) missense probably damaging 1.00
R6760:Akap6 UTSW 12 53,186,561 (GRCm39) missense probably damaging 1.00
R6778:Akap6 UTSW 12 53,072,599 (GRCm39) missense probably damaging 1.00
R6837:Akap6 UTSW 12 53,188,045 (GRCm39) missense probably damaging 1.00
R6896:Akap6 UTSW 12 52,934,277 (GRCm39) missense probably benign 0.06
R6917:Akap6 UTSW 12 53,115,951 (GRCm39) missense probably null 0.97
R6983:Akap6 UTSW 12 52,934,436 (GRCm39) missense probably damaging 1.00
R7142:Akap6 UTSW 12 52,934,147 (GRCm39) missense probably benign 0.02
R7143:Akap6 UTSW 12 52,934,147 (GRCm39) missense probably benign 0.02
R7216:Akap6 UTSW 12 53,187,240 (GRCm39) missense probably benign 0.02
R7297:Akap6 UTSW 12 52,934,147 (GRCm39) missense probably benign 0.02
R7356:Akap6 UTSW 12 52,958,647 (GRCm39) missense probably damaging 1.00
R7378:Akap6 UTSW 12 53,189,357 (GRCm39) missense probably benign 0.00
R7382:Akap6 UTSW 12 53,188,954 (GRCm39) missense probably benign 0.00
R7498:Akap6 UTSW 12 53,189,488 (GRCm39) nonsense probably null
R7542:Akap6 UTSW 12 53,116,017 (GRCm39) missense probably damaging 1.00
R7589:Akap6 UTSW 12 53,188,846 (GRCm39) nonsense probably null
R7676:Akap6 UTSW 12 52,933,633 (GRCm39) missense possibly damaging 0.94
R7814:Akap6 UTSW 12 53,187,744 (GRCm39) missense probably benign 0.28
R7971:Akap6 UTSW 12 53,186,578 (GRCm39) missense probably damaging 1.00
R8039:Akap6 UTSW 12 53,188,459 (GRCm39) missense probably benign 0.00
R8425:Akap6 UTSW 12 52,933,404 (GRCm39) missense probably benign 0.00
R8747:Akap6 UTSW 12 53,188,999 (GRCm39) missense probably benign 0.01
R8885:Akap6 UTSW 12 53,188,319 (GRCm39) missense probably benign
R8956:Akap6 UTSW 12 53,187,127 (GRCm39) missense probably benign 0.00
R8989:Akap6 UTSW 12 52,927,654 (GRCm39) missense probably damaging 1.00
R9014:Akap6 UTSW 12 53,186,403 (GRCm39) missense possibly damaging 0.60
R9031:Akap6 UTSW 12 53,188,831 (GRCm39) missense probably benign 0.36
R9216:Akap6 UTSW 12 52,927,668 (GRCm39) missense probably benign 0.05
R9220:Akap6 UTSW 12 53,187,232 (GRCm39) missense possibly damaging 0.49
R9243:Akap6 UTSW 12 53,188,035 (GRCm39) missense probably benign 0.08
R9286:Akap6 UTSW 12 53,119,254 (GRCm39) missense possibly damaging 0.90
R9347:Akap6 UTSW 12 53,115,894 (GRCm39) missense probably damaging 1.00
R9475:Akap6 UTSW 12 53,057,335 (GRCm39) missense probably damaging 1.00
R9509:Akap6 UTSW 12 53,189,021 (GRCm39) missense probably damaging 0.99
R9523:Akap6 UTSW 12 52,842,672 (GRCm39) missense probably benign 0.02
R9600:Akap6 UTSW 12 52,933,341 (GRCm39) missense probably benign 0.04
R9612:Akap6 UTSW 12 52,958,690 (GRCm39) missense probably damaging 1.00
R9627:Akap6 UTSW 12 53,151,413 (GRCm39) missense
R9666:Akap6 UTSW 12 53,188,318 (GRCm39) missense probably benign
R9784:Akap6 UTSW 12 53,187,853 (GRCm39) missense probably damaging 1.00
X0062:Akap6 UTSW 12 53,189,144 (GRCm39) missense probably benign 0.43
Z1176:Akap6 UTSW 12 53,187,227 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTACTCGTACCTCCAAGGC -3'
(R):5'- TATGTCCCCAGAGCTGTGAC -3'

Sequencing Primer
(F):5'- AAGGCACATTTGGAGGATCCCC -3'
(R):5'- GTGACAGCTAAAAAGATCCTCGTTGC -3'
Posted On 2015-04-17