Mutagenetix > Incidental Mutation

Incidental Mutation 'R3934:Polr3a'

306955

Institutional Source

Beutler Lab

Gene Symbol

Polr3a

Ensembl Gene

ENSMUSG00000025280

Gene Name

polymerase (RNA) III (DNA directed) polypeptide A

Synonyms

RPC1, 9330175N20Rik, RPC155

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3934 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24448696-24487058 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24476101 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 401 (I401V)

Ref Sequence

ENSEMBL: ENSMUSP00000026322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]

AlphaFold

B2RXC6

Predicted Effect

probably benign
Transcript: ENSMUST00000026322
AA Change: I401V

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: I401V

Domain	Start	End	E-Value	Type
Blast:RPOLA_N	122	218	5e-43	BLAST
RPOLA_N	248	553	1.09e-176	SMART
Pfam:RNA_pol_Rpb1_4	728	834	4e-35	PFAM
Pfam:RNA_pol_Rpb1_5	841	1318	1.2e-92	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000223718
AA Change: I401V

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225526

Meta Mutation Damage Score

0.1472

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730507C01Rik	T	A	12: 18,534,081	Y381N	possibly damaging	Het
Adgrf3	T	C	5: 30,200,434		probably benign	Het
Adgrv1	A	G	13: 81,475,047	F3819S	probably benign	Het
Aig1	T	C	10: 13,801,912	D112G	probably damaging	Het
Akap6	C	T	12: 53,140,444	T1547M	possibly damaging	Het
Alk	T	A	17: 72,205,954	I337F	probably damaging	Het
C2cd5	C	T	6: 143,041,380	V499I	possibly damaging	Het
Capn11	A	T	17: 45,634,287		probably benign	Het
Clstn3	G	A	6: 124,457,942	T338I	probably damaging	Het
Cmbl	A	G	15: 31,589,787	D221G	possibly damaging	Het
Enpp2	A	G	15: 54,845,921	V766A	probably benign	Het
Fastk	G	T	5: 24,442,259	S317*	probably null	Het
Fgfr1op2	T	A	6: 146,595,171		probably benign	Het
Gpr85	A	G	6: 13,836,045	F287L	probably benign	Het
Hectd4	G	A	5: 121,320,101		probably null	Het
Hmcn2	T	A	2: 31,380,484		probably null	Het
Hspbp1	A	T	7: 4,664,595	M271K	probably benign	Het
Itgb6	G	A	2: 60,611,411	T685M	possibly damaging	Het
Itih5	G	A	2: 10,245,544	V685I	probably damaging	Het
Kalrn	T	C	16: 34,310,531	S421G	probably benign	Het
Mcm2	G	A	6: 88,893,008	R60C	probably damaging	Het
Mitf	C	T	6: 97,993,253	P54S	probably damaging	Het
Perm1	A	G	4: 156,219,170	T724A	probably benign	Het
Pex5l	T	C	3: 33,007,172	E176G	probably damaging	Het
Polk	A	T	13: 96,501,635	M192K	possibly damaging	Het
Prpf38b	T	C	3: 108,904,425		probably benign	Het
Sema3c	T	C	5: 17,681,940	S330P	probably damaging	Het
Slc16a7	C	A	10: 125,230,843	R309L	probably damaging	Het
Slc35f1	C	T	10: 53,108,218	T358I	probably damaging	Het
Slc39a12	T	A	2: 14,434,363		probably benign	Het
Sod3	T	C	5: 52,368,645	S229P	probably benign	Het
Sorcs3	T	A	19: 48,713,504	V608D	probably damaging	Het
Spink5	G	T	18: 44,016,427	K958N	probably damaging	Het
Ttc7	A	C	17: 87,370,738		probably benign	Het
Ush2a	T	A	1: 188,263,511		probably null	Het
Vmn2r19	T	A	6: 123,315,669	D223E	probably damaging	Het
Vwf	T	A	6: 125,555,499	S87T	probably damaging	Het
Wdr35	G	T	12: 9,008,014	G513C	probably damaging	Het

Other mutations in Polr3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Polr3a	APN	14	24475863	missense	probably benign	0.35
IGL00974:Polr3a	APN	14	24479424	missense	probably benign	0.05
IGL01348:Polr3a	APN	14	24461763	missense	probably damaging	1.00
IGL01464:Polr3a	APN	14	24470681	splice site	probably benign
IGL01785:Polr3a	APN	14	24484120	nonsense	probably null
IGL01786:Polr3a	APN	14	24484120	nonsense	probably null
IGL01936:Polr3a	APN	14	24479188	missense	probably damaging	1.00
IGL02095:Polr3a	APN	14	24454610	missense	possibly damaging	0.91
IGL02454:Polr3a	APN	14	24475823	missense	possibly damaging	0.87
IGL02702:Polr3a	APN	14	24470877	missense	probably benign	0.07
IGL02961:Polr3a	APN	14	24467040	nonsense	probably null
IGL03069:Polr3a	APN	14	24461740	missense	probably damaging	0.99
R0001:Polr3a	UTSW	14	24452189	splice site	probably benign
R0048:Polr3a	UTSW	14	24469255	splice site	probably benign
R0157:Polr3a	UTSW	14	24479186	missense	probably damaging	0.99
R0445:Polr3a	UTSW	14	24454921	missense	probably benign	0.00
R0449:Polr3a	UTSW	14	24484466	missense	probably damaging	0.99
R0597:Polr3a	UTSW	14	24484134	missense	probably benign	0.29
R0604:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0644:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0703:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0754:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0767:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0816:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0817:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0819:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0840:Polr3a	UTSW	14	24452200	missense	possibly damaging	0.95
R1481:Polr3a	UTSW	14	24452548	missense	probably null	0.98
R1644:Polr3a	UTSW	14	24470624	missense	probably damaging	1.00
R1699:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R1704:Polr3a	UTSW	14	24484120	nonsense	probably null
R2363:Polr3a	UTSW	14	24475892	splice site	probably null
R3419:Polr3a	UTSW	14	24467035	missense	probably damaging	1.00
R4296:Polr3a	UTSW	14	24453196	missense	possibly damaging	0.82
R4611:Polr3a	UTSW	14	24452508	splice site	probably null
R4690:Polr3a	UTSW	14	24464281	missense	possibly damaging	0.78
R4934:Polr3a	UTSW	14	24452624	missense	probably benign	0.11
R4947:Polr3a	UTSW	14	24482464	missense	probably benign	0.00
R5232:Polr3a	UTSW	14	24453211	missense	probably benign	0.00
R5263:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5264:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5265:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5282:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5319:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5321:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5323:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5387:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5388:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5401:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5402:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5443:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5444:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5725:Polr3a	UTSW	14	24465387	splice site	probably null
R5841:Polr3a	UTSW	14	24450698	missense	probably benign	0.00
R6408:Polr3a	UTSW	14	24486871	critical splice donor site	probably null
R6704:Polr3a	UTSW	14	24461842	missense	probably damaging	1.00
R7136:Polr3a	UTSW	14	24461815	missense	probably damaging	1.00
R7307:Polr3a	UTSW	14	24459987	missense	probably benign	0.03
R7368:Polr3a	UTSW	14	24467076	missense	probably damaging	0.98
R7800:Polr3a	UTSW	14	24484387	missense	probably null	0.83
R8753:Polr3a	UTSW	14	24463634	nonsense	probably null
R8785:Polr3a	UTSW	14	24452315	missense	probably benign	0.06
R8848:Polr3a	UTSW	14	24450766	missense	probably damaging	1.00
R9025:Polr3a	UTSW	14	24469411	missense	probably damaging	1.00
R9139:Polr3a	UTSW	14	24469348	missense	probably damaging	1.00
R9264:Polr3a	UTSW	14	24470831	missense	probably benign
R9309:Polr3a	UTSW	14	24459999	missense	probably benign
R9363:Polr3a	UTSW	14	24450763	missense	probably damaging	1.00
R9526:Polr3a	UTSW	14	24453245	missense	probably benign	0.00
R9585:Polr3a	UTSW	14	24452221	missense	probably damaging	1.00
Z1088:Polr3a	UTSW	14	24479724	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTCAGGAACCTAAGGGTGCAG -3'
(R):5'- TCCTTAGGTCTAGGCTCCTG -3'

Sequencing Primer
(F):5'- GTGCAGGATATACATGGTCTCTGAAC -3'
(R):5'- AGGTCTAGGCTCCTGTCTGC -3'

Posted On

2015-04-17