Mutagenetix > Incidental Mutation

Incidental Mutation 'R3934:Sorcs3'

306961

Institutional Source

Beutler Lab

Gene Symbol

Sorcs3

Ensembl Gene

ENSMUSG00000063434

Gene Name

sortilin-related VPS10 domain containing receptor 3

Synonyms

6330404A12Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R3934 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48194464-48793944 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 48701943 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 608 (V608D)

Ref Sequence

ENSEMBL: ENSMUSP00000077919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078880]

AlphaFold

Q8VI51

Predicted Effect

probably damaging
Transcript: ENSMUST00000078880
AA Change: V608D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: V608D

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	46	63	N/A	INTRINSIC
low complexity region	69	91	N/A	INTRINSIC
VPS10	216	818	N/A	SMART
Pfam:PKD	823	901	8e-13	PFAM
transmembrane domain	1122	1141	N/A	INTRINSIC

Meta Mutation Damage Score

0.8006

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730507C01Rik	T	A	12: 18,584,082 (GRCm39)	Y381N	possibly damaging	Het
Adgrf3	T	C	5: 30,405,432 (GRCm39)		probably benign	Het
Adgrv1	A	G	13: 81,623,166 (GRCm39)	F3819S	probably benign	Het
Aig1	T	C	10: 13,677,656 (GRCm39)	D112G	probably damaging	Het
Akap6	C	T	12: 53,187,227 (GRCm39)	T1547M	possibly damaging	Het
Alk	T	A	17: 72,512,949 (GRCm39)	I337F	probably damaging	Het
C2cd5	C	T	6: 142,987,106 (GRCm39)	V499I	possibly damaging	Het
Capn11	A	T	17: 45,945,213 (GRCm39)		probably benign	Het
Clstn3	G	A	6: 124,434,901 (GRCm39)	T338I	probably damaging	Het
Cmbl	A	G	15: 31,589,933 (GRCm39)	D221G	possibly damaging	Het
Enpp2	A	G	15: 54,709,317 (GRCm39)	V766A	probably benign	Het
Fastk	G	T	5: 24,647,257 (GRCm39)	S317*	probably null	Het
Fgfr1op2	T	A	6: 146,496,669 (GRCm39)		probably benign	Het
Gpr85	A	G	6: 13,836,044 (GRCm39)	F287L	probably benign	Het
Hectd4	G	A	5: 121,458,164 (GRCm39)		probably null	Het
Hmcn2	T	A	2: 31,270,496 (GRCm39)		probably null	Het
Hspbp1	A	T	7: 4,667,594 (GRCm39)	M271K	probably benign	Het
Itgb6	G	A	2: 60,441,755 (GRCm39)	T685M	possibly damaging	Het
Itih5	G	A	2: 10,250,355 (GRCm39)	V685I	probably damaging	Het
Kalrn	T	C	16: 34,130,901 (GRCm39)	S421G	probably benign	Het
Mcm2	G	A	6: 88,869,990 (GRCm39)	R60C	probably damaging	Het
Mitf	C	T	6: 97,970,214 (GRCm39)	P54S	probably damaging	Het
Perm1	A	G	4: 156,303,627 (GRCm39)	T724A	probably benign	Het
Pex5l	T	C	3: 33,061,321 (GRCm39)	E176G	probably damaging	Het
Polk	A	T	13: 96,638,143 (GRCm39)	M192K	possibly damaging	Het
Polr3a	T	C	14: 24,526,169 (GRCm39)	I401V	probably benign	Het
Prpf38b	T	C	3: 108,811,741 (GRCm39)		probably benign	Het
Sema3c	T	C	5: 17,886,938 (GRCm39)	S330P	probably damaging	Het
Slc16a7	C	A	10: 125,066,712 (GRCm39)	R309L	probably damaging	Het
Slc35f1	C	T	10: 52,984,314 (GRCm39)	T358I	probably damaging	Het
Slc39a12	T	A	2: 14,439,174 (GRCm39)		probably benign	Het
Sod3	T	C	5: 52,525,987 (GRCm39)	S229P	probably benign	Het
Spink5	G	T	18: 44,149,494 (GRCm39)	K958N	probably damaging	Het
Ttc7	A	C	17: 87,678,166 (GRCm39)		probably benign	Het
Ush2a	T	A	1: 187,995,708 (GRCm39)		probably null	Het
Vmn2r19	T	A	6: 123,292,628 (GRCm39)	D223E	probably damaging	Het
Vwf	T	A	6: 125,532,462 (GRCm39)	S87T	probably damaging	Het
Wdr35	G	T	12: 9,058,014 (GRCm39)	G513C	probably damaging	Het

Other mutations in Sorcs3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sorcs3	APN	19	48,672,097 (GRCm39)	critical splice donor site	probably null
IGL00233:Sorcs3	APN	19	48,736,758 (GRCm39)	missense	probably benign	0.12
IGL00482:Sorcs3	APN	19	48,592,303 (GRCm39)	missense	probably benign	0.00
IGL00976:Sorcs3	APN	19	48,755,542 (GRCm39)	missense	probably damaging	1.00
IGL01367:Sorcs3	APN	19	48,784,814 (GRCm39)	missense	probably damaging	1.00
IGL01390:Sorcs3	APN	19	48,778,570 (GRCm39)	missense	probably damaging	1.00
IGL01548:Sorcs3	APN	19	48,782,607 (GRCm39)	missense	possibly damaging	0.87
IGL02162:Sorcs3	APN	19	48,523,970 (GRCm39)	missense	probably damaging	0.98
IGL02165:Sorcs3	APN	19	48,642,511 (GRCm39)	missense	probably benign	0.03
IGL02404:Sorcs3	APN	19	48,692,809 (GRCm39)	splice site	probably benign
IGL02830:Sorcs3	APN	19	48,711,441 (GRCm39)	splice site	probably null
IGL02943:Sorcs3	APN	19	48,748,377 (GRCm39)	missense	probably benign	0.00
R0371:Sorcs3	UTSW	19	48,592,333 (GRCm39)	missense	probably benign	0.00
R0456:Sorcs3	UTSW	19	48,642,483 (GRCm39)	missense	possibly damaging	0.94
R0466:Sorcs3	UTSW	19	48,736,758 (GRCm39)	missense	probably benign	0.12
R0470:Sorcs3	UTSW	19	48,785,956 (GRCm39)	critical splice donor site	probably null
R0536:Sorcs3	UTSW	19	48,791,137 (GRCm39)	nonsense	probably null
R0646:Sorcs3	UTSW	19	48,194,734 (GRCm39)	missense	probably benign	0.10
R0709:Sorcs3	UTSW	19	48,475,845 (GRCm39)	missense	probably benign
R0792:Sorcs3	UTSW	19	48,694,448 (GRCm39)	missense	possibly damaging	0.84
R0831:Sorcs3	UTSW	19	48,682,433 (GRCm39)	missense	probably damaging	1.00
R0836:Sorcs3	UTSW	19	48,475,833 (GRCm39)	missense	probably benign
R1253:Sorcs3	UTSW	19	48,195,175 (GRCm39)	missense	possibly damaging	0.67
R1390:Sorcs3	UTSW	19	48,682,440 (GRCm39)	critical splice donor site	probably null
R1522:Sorcs3	UTSW	19	48,694,448 (GRCm39)	missense	possibly damaging	0.84
R1570:Sorcs3	UTSW	19	48,752,620 (GRCm39)	missense	probably damaging	1.00
R1637:Sorcs3	UTSW	19	48,736,798 (GRCm39)	critical splice donor site	probably null
R1766:Sorcs3	UTSW	19	48,592,314 (GRCm39)	missense	possibly damaging	0.87
R1894:Sorcs3	UTSW	19	48,782,713 (GRCm39)	missense	probably benign	0.23
R2426:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R3789:Sorcs3	UTSW	19	48,387,150 (GRCm39)	missense	possibly damaging	0.46
R3818:Sorcs3	UTSW	19	48,592,343 (GRCm39)	missense	probably benign	0.00
R3824:Sorcs3	UTSW	19	48,711,395 (GRCm39)	missense	probably damaging	1.00
R3936:Sorcs3	UTSW	19	48,701,943 (GRCm39)	missense	probably damaging	1.00
R4190:Sorcs3	UTSW	19	48,737,812 (GRCm39)	missense	possibly damaging	0.69
R4604:Sorcs3	UTSW	19	48,682,353 (GRCm39)	missense	probably benign	0.35
R4644:Sorcs3	UTSW	19	48,672,036 (GRCm39)	missense	probably damaging	1.00
R4774:Sorcs3	UTSW	19	48,782,602 (GRCm39)	missense	probably benign	0.23
R4801:Sorcs3	UTSW	19	48,387,183 (GRCm39)	missense	possibly damaging	0.46
R4802:Sorcs3	UTSW	19	48,387,183 (GRCm39)	missense	possibly damaging	0.46
R4945:Sorcs3	UTSW	19	48,752,587 (GRCm39)	missense	possibly damaging	0.50
R5049:Sorcs3	UTSW	19	48,748,390 (GRCm39)	missense	possibly damaging	0.93
R5175:Sorcs3	UTSW	19	48,748,284 (GRCm39)	critical splice acceptor site	probably null
R5342:Sorcs3	UTSW	19	48,784,911 (GRCm39)	splice site	probably null
R5848:Sorcs3	UTSW	19	48,776,950 (GRCm39)	missense	probably damaging	1.00
R5959:Sorcs3	UTSW	19	48,737,835 (GRCm39)	missense	probably damaging	1.00
R5977:Sorcs3	UTSW	19	48,784,889 (GRCm39)	missense	probably damaging	1.00
R6155:Sorcs3	UTSW	19	48,387,136 (GRCm39)	missense	possibly damaging	0.94
R6222:Sorcs3	UTSW	19	48,748,296 (GRCm39)	missense	possibly damaging	0.57
R6268:Sorcs3	UTSW	19	48,778,605 (GRCm39)	missense	probably damaging	1.00
R6416:Sorcs3	UTSW	19	48,791,198 (GRCm39)	missense	probably damaging	1.00
R6425:Sorcs3	UTSW	19	48,752,746 (GRCm39)	critical splice donor site	probably null
R6623:Sorcs3	UTSW	19	48,776,944 (GRCm39)	missense	probably benign	0.00
R6767:Sorcs3	UTSW	19	48,702,010 (GRCm39)	missense	probably damaging	0.99
R6888:Sorcs3	UTSW	19	48,682,263 (GRCm39)	missense	possibly damaging	0.83
R6955:Sorcs3	UTSW	19	48,737,782 (GRCm39)	missense	possibly damaging	0.82
R7106:Sorcs3	UTSW	19	48,694,402 (GRCm39)	missense	probably damaging	1.00
R7379:Sorcs3	UTSW	19	48,760,705 (GRCm39)	missense	possibly damaging	0.69
R7953:Sorcs3	UTSW	19	48,752,734 (GRCm39)	missense	possibly damaging	0.84
R8043:Sorcs3	UTSW	19	48,752,734 (GRCm39)	missense	possibly damaging	0.84
R8242:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8343:Sorcs3	UTSW	19	48,692,808 (GRCm39)	splice site	probably null
R8433:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8435:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8436:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8940:Sorcs3	UTSW	19	48,784,908 (GRCm39)	critical splice donor site	probably null
R8956:Sorcs3	UTSW	19	48,737,810 (GRCm39)	nonsense	probably null
R9051:Sorcs3	UTSW	19	48,194,809 (GRCm39)	missense	probably benign
R9119:Sorcs3	UTSW	19	48,642,433 (GRCm39)	missense	possibly damaging	0.92
R9166:Sorcs3	UTSW	19	48,784,811 (GRCm39)	missense	probably benign	0.01
R9328:Sorcs3	UTSW	19	48,785,950 (GRCm39)	missense	probably damaging	1.00
R9489:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R9605:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R9757:Sorcs3	UTSW	19	48,711,363 (GRCm39)	missense	probably damaging	1.00
X0018:Sorcs3	UTSW	19	48,760,728 (GRCm39)	missense	probably damaging	1.00
Z1176:Sorcs3	UTSW	19	48,634,243 (GRCm39)	missense	probably damaging	1.00
Z1177:Sorcs3	UTSW	19	48,692,739 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTACGAATGCCATTTGAGTG -3'
(R):5'- TTAAGAAAACAGTGTGCTGGTG -3'

Sequencing Primer
(F):5'- AGAGCATCTGTTCTCTGTAAGTC -3'
(R):5'- CAGTGTGCTGGTGAGGAAATG -3'

Posted On

2015-04-17