Incidental Mutation 'R3922:Slc19a3'
ID 306963
Institutional Source Beutler Lab
Gene Symbol Slc19a3
Ensembl Gene ENSMUSG00000038496
Gene Name solute carrier family 19, member 3
Synonyms ThTr2, A230084E24Rik
MMRRC Submission 040819-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.129) question?
Stock # R3922 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 82990244-83016169 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 83000678 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 113 (F113Y)
Ref Sequence ENSEMBL: ENSMUSP00000126646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]
AlphaFold Q99PL8
Predicted Effect probably damaging
Transcript: ENSMUST00000045560
AA Change: F113Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: F113Y

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142805
Predicted Effect probably damaging
Transcript: ENSMUST00000164473
AA Change: F113Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: F113Y

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Meta Mutation Damage Score 0.4327 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
4921504E06Rik T A 2: 19,485,371 (GRCm39) E432V probably benign Het
Ahnak G A 19: 8,983,692 (GRCm39) D1659N probably benign Het
Arfgap2 C T 2: 91,105,150 (GRCm39) R405W probably damaging Het
Arhgef28 A G 13: 98,130,452 (GRCm39) L462P possibly damaging Het
Arid1b T C 17: 5,393,316 (GRCm39) V2282A probably damaging Het
Becn2 T C 1: 175,748,852 (GRCm39) V306A probably benign Het
Cdkl1 G T 12: 69,803,373 (GRCm39) R168S probably damaging Het
Cep70 T A 9: 99,157,632 (GRCm39) *117R probably null Het
Cnnm1 A G 19: 43,428,884 (GRCm39) M1V probably null Het
Cntrl A G 2: 35,019,751 (GRCm39) E526G probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Ddx59 T A 1: 136,344,482 (GRCm39) V51D probably benign Het
Dtd2 G C 12: 52,051,734 (GRCm39) probably null Het
Eea1 T A 10: 95,872,495 (GRCm39) N1068K probably benign Het
Egfr T A 11: 16,831,495 (GRCm39) C555S probably damaging Het
Esd A T 14: 74,980,667 (GRCm39) Q130H probably benign Het
Gpr89 A T 3: 96,798,215 (GRCm39) I147N probably damaging Het
H2-M10.1 T A 17: 36,636,577 (GRCm39) I76L probably benign Het
Lgi4 A T 7: 30,766,873 (GRCm39) D300V probably benign Het
Lrp1b C A 2: 40,567,593 (GRCm39) V276L unknown Het
Lrp2 T C 2: 69,336,720 (GRCm39) K1351E probably benign Het
Mroh8 T C 2: 157,064,731 (GRCm39) I782V probably benign Het
Msrb1 T C 17: 24,959,057 (GRCm39) S70P probably damaging Het
Nek10 T C 14: 14,861,585 (GRCm38) M547T possibly damaging Het
Or51ah3 T C 7: 103,209,912 (GRCm39) V76A probably benign Het
Or6c2b C A 10: 128,947,482 (GRCm39) V271F possibly damaging Het
Or9i2 T C 19: 13,816,130 (GRCm39) T136A probably damaging Het
P4htm T C 9: 108,460,094 (GRCm39) N227D probably benign Het
Plekhm2 T C 4: 141,356,843 (GRCm39) T787A probably benign Het
Pramel5 A G 4: 143,999,622 (GRCm39) L155P probably damaging Het
Sbno1 T C 5: 124,519,993 (GRCm39) Y1122C probably damaging Het
Scn9a T A 2: 66,357,217 (GRCm39) D1028V possibly damaging Het
Sft2d1 G T 17: 8,537,714 (GRCm39) L34F possibly damaging Het
Slc27a3 G T 3: 90,294,392 (GRCm39) H460N possibly damaging Het
Slc35g2 A T 9: 100,434,780 (GRCm39) I297N probably benign Het
Ssh1 T G 5: 114,080,769 (GRCm39) Q865P possibly damaging Het
Trp63 A G 16: 25,707,759 (GRCm39) D583G probably damaging Het
Usp28 T C 9: 48,942,223 (GRCm39) probably null Het
Wdr43 A G 17: 71,945,296 (GRCm39) probably benign Het
Zfhx4 A G 3: 5,465,707 (GRCm39) Y1955C probably damaging Het
Zfp108 G A 7: 23,960,773 (GRCm39) G455R probably damaging Het
Zfp353-ps A T 8: 42,536,049 (GRCm39) noncoding transcript Het
Other mutations in Slc19a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Slc19a3 APN 1 82,992,557 (GRCm39) missense probably damaging 0.99
tag UTSW 1 83,003,981 (GRCm39) missense probably damaging 1.00
R0437:Slc19a3 UTSW 1 83,000,286 (GRCm39) missense probably benign 0.00
R0526:Slc19a3 UTSW 1 83,000,454 (GRCm39) missense probably damaging 1.00
R1160:Slc19a3 UTSW 1 83,000,413 (GRCm39) missense possibly damaging 0.85
R1306:Slc19a3 UTSW 1 83,000,483 (GRCm39) missense probably damaging 1.00
R1832:Slc19a3 UTSW 1 83,000,468 (GRCm39) missense probably damaging 0.99
R1938:Slc19a3 UTSW 1 82,997,089 (GRCm39) missense possibly damaging 0.76
R1961:Slc19a3 UTSW 1 83,000,519 (GRCm39) missense probably benign 0.00
R2058:Slc19a3 UTSW 1 82,992,512 (GRCm39) missense probably damaging 0.98
R2200:Slc19a3 UTSW 1 83,000,664 (GRCm39) missense probably damaging 0.96
R2245:Slc19a3 UTSW 1 82,991,691 (GRCm39) missense possibly damaging 0.84
R2261:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R2404:Slc19a3 UTSW 1 83,000,756 (GRCm39) missense probably benign 0.16
R3891:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R3892:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R3907:Slc19a3 UTSW 1 82,992,534 (GRCm39) missense possibly damaging 0.76
R3912:Slc19a3 UTSW 1 83,000,424 (GRCm39) missense probably benign 0.09
R3923:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R3961:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R4083:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R4106:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R4107:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R4109:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R4667:Slc19a3 UTSW 1 83,000,520 (GRCm39) missense probably benign
R4768:Slc19a3 UTSW 1 83,000,834 (GRCm39) missense probably damaging 1.00
R4769:Slc19a3 UTSW 1 82,997,062 (GRCm39) missense probably damaging 1.00
R5001:Slc19a3 UTSW 1 83,000,341 (GRCm39) missense probably benign 0.33
R5538:Slc19a3 UTSW 1 83,000,282 (GRCm39) missense possibly damaging 0.51
R5588:Slc19a3 UTSW 1 83,000,776 (GRCm39) nonsense probably null
R6143:Slc19a3 UTSW 1 83,004,060 (GRCm39) missense probably benign 0.00
R6546:Slc19a3 UTSW 1 83,004,081 (GRCm39) missense probably benign 0.02
R6547:Slc19a3 UTSW 1 83,000,621 (GRCm39) missense probably damaging 1.00
R7059:Slc19a3 UTSW 1 83,000,090 (GRCm39) missense probably damaging 1.00
R7497:Slc19a3 UTSW 1 82,991,649 (GRCm39) missense probably damaging 1.00
R7509:Slc19a3 UTSW 1 83,003,981 (GRCm39) missense probably damaging 1.00
R7584:Slc19a3 UTSW 1 83,000,469 (GRCm39) missense possibly damaging 0.79
R7810:Slc19a3 UTSW 1 82,997,162 (GRCm39) missense probably benign 0.02
R8150:Slc19a3 UTSW 1 83,000,216 (GRCm39) missense probably damaging 1.00
R8412:Slc19a3 UTSW 1 82,992,533 (GRCm39) missense probably damaging 0.97
R8970:Slc19a3 UTSW 1 83,000,822 (GRCm39) missense probably damaging 1.00
R9314:Slc19a3 UTSW 1 83,000,094 (GRCm39) missense possibly damaging 0.62
R9671:Slc19a3 UTSW 1 83,000,297 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGGCAGGTTCGTCAGGGATAC -3'
(R):5'- AAATGTGTTGTGCTTCTGACC -3'

Sequencing Primer
(F):5'- ATACTCCGACAGTAGCTG -3'
(R):5'- GACAAATGAGATCCTTCCTGTTTGG -3'
Posted On 2015-04-17