Incidental Mutation 'R3922:4921504E06Rik'
ID306965
Institutional Source Beutler Lab
Gene Symbol 4921504E06Rik
Ensembl Gene ENSMUSG00000026734
Gene NameRIKEN cDNA 4921504E06 gene
Synonyms
MMRRC Submission 040819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R3922 (G1)
Quality Score160
Status Validated
Chromosome2
Chromosomal Location19462837-19553914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19480560 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 432 (E432V)
Ref Sequence ENSEMBL: ENSMUSP00000058720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062060]
Predicted Effect probably benign
Transcript: ENSMUST00000062060
AA Change: E432V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000058720
Gene: ENSMUSG00000026734
AA Change: E432V

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:DUF4709 36 145 1e-45 PFAM
coiled coil region 165 257 N/A INTRINSIC
low complexity region 366 386 N/A INTRINSIC
coiled coil region 417 463 N/A INTRINSIC
Pfam:DUF4724 477 559 3.9e-24 PFAM
Meta Mutation Damage Score 0.0751 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Arhgef28 A G 13: 97,993,944 L462P possibly damaging Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cep70 T A 9: 99,275,579 *117R probably null Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Cntrl A G 2: 35,129,739 E526G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Eea1 T A 10: 96,036,633 N1068K probably benign Het
Egfr T A 11: 16,881,495 C555S probably damaging Het
Esd A T 14: 74,743,227 Q130H probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Gpr89 A T 3: 96,890,899 I147N probably damaging Het
H2-M10.1 T A 17: 36,325,685 I76L probably benign Het
Lgi4 A T 7: 31,067,448 D300V probably benign Het
Lrp1b C A 2: 40,677,581 V276L unknown Het
Lrp2 T C 2: 69,506,376 K1351E probably benign Het
Mroh8 T C 2: 157,222,811 I782V probably benign Het
Msrb1 T C 17: 24,740,083 S70P probably damaging Het
Nek10 T C 14: 14,861,585 M547T possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Olfr615 T C 7: 103,560,705 V76A probably benign Het
Olfr769 C A 10: 129,111,613 V271F possibly damaging Het
P4htm T C 9: 108,582,895 N227D probably benign Het
Plekhm2 T C 4: 141,629,532 T787A probably benign Het
Pramel5 A G 4: 144,273,052 L155P probably damaging Het
Sbno1 T C 5: 124,381,930 Y1122C probably damaging Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Sft2d1 G T 17: 8,318,882 L34F possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc27a3 G T 3: 90,387,085 H460N possibly damaging Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Ssh1 T G 5: 113,942,708 Q865P possibly damaging Het
Trp63 A G 16: 25,889,009 D583G probably damaging Het
Usp28 T C 9: 49,030,923 probably null Het
Wdr43 A G 17: 71,638,301 probably benign Het
Zfhx4 A G 3: 5,400,647 Y1955C probably damaging Het
Zfp108 G A 7: 24,261,348 G455R probably damaging Het
Zfp353-ps A T 8: 42,083,012 noncoding transcript Het
Other mutations in 4921504E06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:4921504E06Rik APN 2 19540371 missense probably benign 0.06
IGL01590:4921504E06Rik APN 2 19477779 splice site probably benign
IGL02264:4921504E06Rik APN 2 19542369 splice site probably null
IGL02591:4921504E06Rik APN 2 19480438 missense probably benign 0.26
H8786:4921504E06Rik UTSW 2 19494094 missense probably benign 0.04
R0545:4921504E06Rik UTSW 2 19542376 missense probably damaging 1.00
R0762:4921504E06Rik UTSW 2 19477856 missense probably damaging 0.97
R1325:4921504E06Rik UTSW 2 19495127 missense possibly damaging 0.71
R1456:4921504E06Rik UTSW 2 19480920 critical splice donor site probably null
R2013:4921504E06Rik UTSW 2 19540313 missense probably benign 0.01
R2089:4921504E06Rik UTSW 2 19517546 missense probably damaging 1.00
R2091:4921504E06Rik UTSW 2 19517546 missense probably damaging 1.00
R2091:4921504E06Rik UTSW 2 19517546 missense probably damaging 1.00
R3982:4921504E06Rik UTSW 2 19542369 splice site probably null
R3983:4921504E06Rik UTSW 2 19542369 splice site probably null
R4074:4921504E06Rik UTSW 2 19480590 missense probably damaging 0.96
R4995:4921504E06Rik UTSW 2 19494184 nonsense probably null
R5303:4921504E06Rik UTSW 2 19516299 missense possibly damaging 0.92
R5308:4921504E06Rik UTSW 2 19524081 missense probably damaging 1.00
R6227:4921504E06Rik UTSW 2 19553770 splice site probably null
R6253:4921504E06Rik UTSW 2 19524118 missense possibly damaging 0.53
R6268:4921504E06Rik UTSW 2 19540408 missense probably benign 0.10
R6496:4921504E06Rik UTSW 2 19540406 missense probably benign 0.17
R7196:4921504E06Rik UTSW 2 19493995 missense probably benign 0.00
R7472:4921504E06Rik UTSW 2 19540408 missense probably benign 0.10
R8146:4921504E06Rik UTSW 2 19494003 missense possibly damaging 0.83
R8150:4921504E06Rik UTSW 2 19533824 missense probably benign 0.10
Z1177:4921504E06Rik UTSW 2 19480532 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CACACTGTACCTGTTCTTGAGG -3'
(R):5'- TGACTTTCAAGGGTCTCTCATTG -3'

Sequencing Primer
(F):5'- CACTGTACCTGTTCTTGAGGATAAG -3'
(R):5'- AGGGTCTCTCATTGTTCTCCCAAAAG -3'
Posted On2015-04-17