Incidental Mutation 'R3922:Mroh8'
ID306971
Institutional Source Beutler Lab
Gene Symbol Mroh8
Ensembl Gene ENSMUSG00000074627
Gene Namemaestro heat-like repeat family member 8
Synonyms4922505G16Rik
MMRRC Submission 040819-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R3922 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location157208550-157279549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 157222811 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 782 (I782V)
Ref Sequence ENSEMBL: ENSMUSP00000124362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143663]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141081
Predicted Effect probably benign
Transcript: ENSMUST00000143663
AA Change: I782V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000124362
Gene: ENSMUSG00000074627
AA Change: I782V

DomainStartEndE-ValueType
low complexity region 189 200 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
SCOP:d1qbkb_ 724 1024 8e-10 SMART
Meta Mutation Damage Score 0.0727 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the maestro heat-like repeat family. The exact function of this gene is not known, however, in a genome-wide association study using hippocampal atrophy as a quantitative trait, this gene has been associated with Alzheimer's disease (PMID:19668339). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4921504E06Rik T A 2: 19,480,560 E432V probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Arhgef28 A G 13: 97,993,944 L462P possibly damaging Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cep70 T A 9: 99,275,579 *117R probably null Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Cntrl A G 2: 35,129,739 E526G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Eea1 T A 10: 96,036,633 N1068K probably benign Het
Egfr T A 11: 16,881,495 C555S probably damaging Het
Esd A T 14: 74,743,227 Q130H probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Gpr89 A T 3: 96,890,899 I147N probably damaging Het
H2-M10.1 T A 17: 36,325,685 I76L probably benign Het
Lgi4 A T 7: 31,067,448 D300V probably benign Het
Lrp1b C A 2: 40,677,581 V276L unknown Het
Lrp2 T C 2: 69,506,376 K1351E probably benign Het
Msrb1 T C 17: 24,740,083 S70P probably damaging Het
Nek10 T C 14: 14,861,585 M547T possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Olfr615 T C 7: 103,560,705 V76A probably benign Het
Olfr769 C A 10: 129,111,613 V271F possibly damaging Het
P4htm T C 9: 108,582,895 N227D probably benign Het
Plekhm2 T C 4: 141,629,532 T787A probably benign Het
Pramel5 A G 4: 144,273,052 L155P probably damaging Het
Sbno1 T C 5: 124,381,930 Y1122C probably damaging Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Sft2d1 G T 17: 8,318,882 L34F possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc27a3 G T 3: 90,387,085 H460N possibly damaging Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Ssh1 T G 5: 113,942,708 Q865P possibly damaging Het
Trp63 A G 16: 25,889,009 D583G probably damaging Het
Usp28 T C 9: 49,030,923 probably null Het
Wdr43 A G 17: 71,638,301 probably benign Het
Zfhx4 A G 3: 5,400,647 Y1955C probably damaging Het
Zfp108 G A 7: 24,261,348 G455R probably damaging Het
Zfp353-ps A T 8: 42,083,012 noncoding transcript Het
Other mutations in Mroh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Mroh8 APN 2 157216914 missense probably damaging 1.00
IGL00691:Mroh8 APN 2 157238307 splice site probably benign
IGL00708:Mroh8 APN 2 157220170 missense probably damaging 1.00
IGL01526:Mroh8 APN 2 157238312 splice site probably benign
IGL01992:Mroh8 APN 2 157213696 missense probably damaging 1.00
IGL02076:Mroh8 APN 2 157271962 critical splice donor site probably null
IGL02308:Mroh8 APN 2 157254973 missense probably damaging 1.00
IGL02592:Mroh8 APN 2 157216969 missense probably damaging 0.96
PIT4378001:Mroh8 UTSW 2 157228700 missense possibly damaging 0.73
PIT4449001:Mroh8 UTSW 2 157225534 missense probably damaging 1.00
R0039:Mroh8 UTSW 2 157229929 missense possibly damaging 0.92
R0039:Mroh8 UTSW 2 157229929 missense possibly damaging 0.92
R0107:Mroh8 UTSW 2 157225468 missense probably benign 0.01
R0511:Mroh8 UTSW 2 157229918 missense probably damaging 1.00
R0523:Mroh8 UTSW 2 157224036 missense probably damaging 1.00
R0619:Mroh8 UTSW 2 157265081 missense possibly damaging 0.69
R1222:Mroh8 UTSW 2 157241854 splice site probably benign
R1418:Mroh8 UTSW 2 157241854 splice site probably benign
R1430:Mroh8 UTSW 2 157269525 missense possibly damaging 0.69
R1458:Mroh8 UTSW 2 157221304 missense probably damaging 1.00
R1509:Mroh8 UTSW 2 157233205 missense probably benign 0.14
R1528:Mroh8 UTSW 2 157230055 missense probably damaging 1.00
R1703:Mroh8 UTSW 2 157271976 missense probably benign 0.01
R1795:Mroh8 UTSW 2 157269551 missense probably benign 0.16
R1982:Mroh8 UTSW 2 157271975 missense possibly damaging 0.52
R4024:Mroh8 UTSW 2 157256352 missense probably benign 0.32
R4030:Mroh8 UTSW 2 157213720 missense probably damaging 1.00
R4200:Mroh8 UTSW 2 157241810 missense probably benign 0.10
R4492:Mroh8 UTSW 2 157258040 missense probably damaging 1.00
R4900:Mroh8 UTSW 2 157228727 missense probably benign 0.05
R5396:Mroh8 UTSW 2 157228656 missense possibly damaging 0.92
R5464:Mroh8 UTSW 2 157221230 missense probably damaging 1.00
R6008:Mroh8 UTSW 2 157253064 missense probably benign 0.40
R6220:Mroh8 UTSW 2 157233163 missense probably benign
R6661:Mroh8 UTSW 2 157225627 missense probably benign
R7000:Mroh8 UTSW 2 157216977 missense probably benign 0.03
R7024:Mroh8 UTSW 2 157221263 missense probably benign
R7221:Mroh8 UTSW 2 157229917 missense probably benign 0.06
R7549:Mroh8 UTSW 2 157269572 missense probably benign 0.01
R7593:Mroh8 UTSW 2 157229947 missense probably damaging 1.00
R7604:Mroh8 UTSW 2 157269564 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TACCCGCATAACTCCTAGGTATAAAG -3'
(R):5'- TTGTTGGGAAGGTAGCTCCC -3'

Sequencing Primer
(F):5'- TCCTAGGTATAAAGTTAGAGCGGTAC -3'
(R):5'- AAGGTAGCTCCCTCCAGG -3'
Posted On2015-04-17