Incidental Mutation 'R3922:Slc27a3'
ID306973
Institutional Source Beutler Lab
Gene Symbol Slc27a3
Ensembl Gene ENSMUSG00000027932
Gene Namesolute carrier family 27 (fatty acid transporter), member 3
SynonymsAcsvl3, fatty acid transport protein 3, FATP3
MMRRC Submission 040819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R3922 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90385239-90389938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 90387085 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 460 (H460N)
Ref Sequence ENSEMBL: ENSMUSP00000029541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029541] [ENSMUST00000029542] [ENSMUST00000071488] [ENSMUST00000196530]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029541
AA Change: H460N

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029541
Gene: ENSMUSG00000027932
AA Change: H460N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 38 56 N/A INTRINSIC
Pfam:AMP-binding 138 535 9.2e-62 PFAM
Pfam:AMP-binding_C 543 619 9.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029542
SMART Domains Protein: ENSMUSP00000029542
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071488
SMART Domains Protein: ENSMUSP00000071422
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127064
Predicted Effect unknown
Transcript: ENSMUST00000132041
AA Change: H425N
SMART Domains Protein: ENSMUSP00000122599
Gene: ENSMUSG00000027932
AA Change: H425N

DomainStartEndE-ValueType
low complexity region 40 64 N/A INTRINSIC
low complexity region 68 89 N/A INTRINSIC
low complexity region 91 106 N/A INTRINSIC
Pfam:AMP-binding 147 501 5.3e-50 PFAM
Pfam:AMP-binding_C 509 585 2.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153978
Predicted Effect probably benign
Transcript: ENSMUST00000196530
SMART Domains Protein: ENSMUSP00000143196
Gene: ENSMUSG00000027933

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 268 497 5.7e-114 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1018 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199992
Meta Mutation Damage Score 0.0835 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a family of integral membrane proteins and encodes a protein that is involved in lipid metabolism. The increased expression of this gene in human neural stem cells derived from induced pluripotent stem cells suggests that it plays an important role in early brain development. Naturally occurring mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4921504E06Rik T A 2: 19,480,560 E432V probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Arhgef28 A G 13: 97,993,944 L462P possibly damaging Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cep70 T A 9: 99,275,579 *117R probably null Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Cntrl A G 2: 35,129,739 E526G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Eea1 T A 10: 96,036,633 N1068K probably benign Het
Egfr T A 11: 16,881,495 C555S probably damaging Het
Esd A T 14: 74,743,227 Q130H probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Gpr89 A T 3: 96,890,899 I147N probably damaging Het
H2-M10.1 T A 17: 36,325,685 I76L probably benign Het
Lgi4 A T 7: 31,067,448 D300V probably benign Het
Lrp1b C A 2: 40,677,581 V276L unknown Het
Lrp2 T C 2: 69,506,376 K1351E probably benign Het
Mroh8 T C 2: 157,222,811 I782V probably benign Het
Msrb1 T C 17: 24,740,083 S70P probably damaging Het
Nek10 T C 14: 14,861,585 M547T possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Olfr615 T C 7: 103,560,705 V76A probably benign Het
Olfr769 C A 10: 129,111,613 V271F possibly damaging Het
P4htm T C 9: 108,582,895 N227D probably benign Het
Plekhm2 T C 4: 141,629,532 T787A probably benign Het
Pramel5 A G 4: 144,273,052 L155P probably damaging Het
Sbno1 T C 5: 124,381,930 Y1122C probably damaging Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Sft2d1 G T 17: 8,318,882 L34F possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Ssh1 T G 5: 113,942,708 Q865P possibly damaging Het
Trp63 A G 16: 25,889,009 D583G probably damaging Het
Usp28 T C 9: 49,030,923 probably null Het
Wdr43 A G 17: 71,638,301 probably benign Het
Zfhx4 A G 3: 5,400,647 Y1955C probably damaging Het
Zfp108 G A 7: 24,261,348 G455R probably damaging Het
Zfp353-ps A T 8: 42,083,012 noncoding transcript Het
Other mutations in Slc27a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Slc27a3 APN 3 90385441 nonsense probably null
IGL01080:Slc27a3 APN 3 90385460 missense probably benign 0.17
IGL01313:Slc27a3 APN 3 90386554 missense probably damaging 1.00
IGL01358:Slc27a3 APN 3 90386552 missense probably damaging 1.00
IGL02261:Slc27a3 APN 3 90387695 missense probably benign
R0557:Slc27a3 UTSW 3 90386856 missense probably damaging 1.00
R1922:Slc27a3 UTSW 3 90386317 missense probably benign
R2032:Slc27a3 UTSW 3 90387397 missense probably damaging 0.99
R4278:Slc27a3 UTSW 3 90389188 unclassified probably benign
R4432:Slc27a3 UTSW 3 90387340 missense probably damaging 0.99
R4433:Slc27a3 UTSW 3 90387340 missense probably damaging 0.99
R4672:Slc27a3 UTSW 3 90387646 missense possibly damaging 0.90
R5183:Slc27a3 UTSW 3 90389170 critical splice donor site probably null
R5201:Slc27a3 UTSW 3 90389219 missense probably benign 0.41
R5328:Slc27a3 UTSW 3 90386832 missense probably damaging 1.00
R5405:Slc27a3 UTSW 3 90387075 missense probably benign 0.05
R5477:Slc27a3 UTSW 3 90386839 missense probably benign
R5743:Slc27a3 UTSW 3 90387072 missense probably benign 0.38
R6344:Slc27a3 UTSW 3 90387654 nonsense probably null
R6450:Slc27a3 UTSW 3 90385470 missense probably damaging 0.97
R6988:Slc27a3 UTSW 3 90386290 missense probably benign 0.01
R7204:Slc27a3 UTSW 3 90389726 missense probably benign 0.07
R7736:Slc27a3 UTSW 3 90389433 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CTTCAGCAGCTTGTCCTTGG -3'
(R):5'- CCTGGCTTTACAAGGTGAGAGAC -3'

Sequencing Primer
(F):5'- AGCTTGTCCTTGGCCAGC -3'
(R):5'- CTTTACAAGGTGAGAGACAGAGTG -3'
Posted On2015-04-17