Incidental Mutation 'R3922:Gpr89'
ID306974
Institutional Source Beutler Lab
Gene Symbol Gpr89
Ensembl Gene ENSMUSG00000028096
Gene NameG protein-coupled receptor 89
Synonyms4933412D19Rik, SH120
MMRRC Submission 040819-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R3922 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96868281-96905346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96890899 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 147 (I147N)
Ref Sequence ENSEMBL: ENSMUSP00000029738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029738] [ENSMUST00000154750]
Predicted Effect probably damaging
Transcript: ENSMUST00000029738
AA Change: I147N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029738
Gene: ENSMUSG00000028096
AA Change: I147N

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 110 127 N/A INTRINSIC
Pfam:GPHR_N 140 207 1.1e-31 PFAM
Pfam:ABA_GPCR 276 446 4.9e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146645
Predicted Effect probably benign
Transcript: ENSMUST00000154750
SMART Domains Protein: ENSMUSP00000116016
Gene: ENSMUSG00000028096

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199586
Meta Mutation Damage Score 0.8850 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4921504E06Rik T A 2: 19,480,560 E432V probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Arhgef28 A G 13: 97,993,944 L462P possibly damaging Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cep70 T A 9: 99,275,579 *117R probably null Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Cntrl A G 2: 35,129,739 E526G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Eea1 T A 10: 96,036,633 N1068K probably benign Het
Egfr T A 11: 16,881,495 C555S probably damaging Het
Esd A T 14: 74,743,227 Q130H probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
H2-M10.1 T A 17: 36,325,685 I76L probably benign Het
Lgi4 A T 7: 31,067,448 D300V probably benign Het
Lrp1b C A 2: 40,677,581 V276L unknown Het
Lrp2 T C 2: 69,506,376 K1351E probably benign Het
Mroh8 T C 2: 157,222,811 I782V probably benign Het
Msrb1 T C 17: 24,740,083 S70P probably damaging Het
Nek10 T C 14: 14,861,585 M547T possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Olfr615 T C 7: 103,560,705 V76A probably benign Het
Olfr769 C A 10: 129,111,613 V271F possibly damaging Het
P4htm T C 9: 108,582,895 N227D probably benign Het
Plekhm2 T C 4: 141,629,532 T787A probably benign Het
Pramel5 A G 4: 144,273,052 L155P probably damaging Het
Sbno1 T C 5: 124,381,930 Y1122C probably damaging Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Sft2d1 G T 17: 8,318,882 L34F possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc27a3 G T 3: 90,387,085 H460N possibly damaging Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Ssh1 T G 5: 113,942,708 Q865P possibly damaging Het
Trp63 A G 16: 25,889,009 D583G probably damaging Het
Usp28 T C 9: 49,030,923 probably null Het
Wdr43 A G 17: 71,638,301 probably benign Het
Zfhx4 A G 3: 5,400,647 Y1955C probably damaging Het
Zfp108 G A 7: 24,261,348 G455R probably damaging Het
Zfp353-ps A T 8: 42,083,012 noncoding transcript Het
Other mutations in Gpr89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Gpr89 APN 3 96898523 missense probably damaging 1.00
IGL00757:Gpr89 APN 3 96871534 missense probably benign 0.00
IGL01114:Gpr89 APN 3 96893549 missense probably damaging 0.98
IGL02417:Gpr89 APN 3 96897425 nonsense probably null
explorer UTSW 3 96880069 splice site probably null
R0207:Gpr89 UTSW 3 96871480 missense probably damaging 0.99
R0650:Gpr89 UTSW 3 96897324 splice site probably benign
R0704:Gpr89 UTSW 3 96880168 critical splice acceptor site probably null
R1496:Gpr89 UTSW 3 96905210 missense probably benign 0.00
R1869:Gpr89 UTSW 3 96875659 missense probably benign 0.16
R1913:Gpr89 UTSW 3 96875633 missense possibly damaging 0.91
R2264:Gpr89 UTSW 3 96872515 missense probably damaging 0.99
R2276:Gpr89 UTSW 3 96897427 missense probably damaging 1.00
R3822:Gpr89 UTSW 3 96892944 missense probably benign 0.03
R4984:Gpr89 UTSW 3 96905196 missense probably benign 0.02
R5761:Gpr89 UTSW 3 96892880 missense probably damaging 1.00
R6185:Gpr89 UTSW 3 96890833 missense probably damaging 0.99
R7063:Gpr89 UTSW 3 96875698 missense probably damaging 1.00
R7164:Gpr89 UTSW 3 96871398 missense probably benign 0.04
R7172:Gpr89 UTSW 3 96880069 splice site probably null
R7215:Gpr89 UTSW 3 96880088 missense probably damaging 1.00
R7536:Gpr89 UTSW 3 96890893 missense probably damaging 0.96
R7708:Gpr89 UTSW 3 96880625 missense possibly damaging 0.81
R7849:Gpr89 UTSW 3 96871490 nonsense probably null
R8273:Gpr89 UTSW 3 96905189 missense probably benign
RF019:Gpr89 UTSW 3 96905193 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGTTGTCCACTGGAAAGATG -3'
(R):5'- AGGCAAAGATCAGCAGCCTG -3'

Sequencing Primer
(F):5'- ATGCCTGTAATCCCAGTGTTCAGG -3'
(R):5'- GTAACTCCAGTTCCAGGGAATTC -3'
Posted On2015-04-17