Incidental Mutation 'R0375:Hbs1l'
ID30698
Institutional Source Beutler Lab
Gene Symbol Hbs1l
Ensembl Gene ENSMUSG00000019977
Gene NameHbs1-like (S. cerevisiae)
Synonyms2810035F15Rik, eRFS
MMRRC Submission 038581-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0375 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location21295979-21368898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21342541 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 312 (D312E)
Ref Sequence ENSEMBL: ENSMUSP00000151689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020153] [ENSMUST00000218714] [ENSMUST00000219915]
Predicted Effect probably benign
Transcript: ENSMUST00000020153
AA Change: D309E

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020153
Gene: ENSMUSG00000019977
AA Change: D309E

DomainStartEndE-ValueType
Pfam:HBS1_N 33 125 1e-22 PFAM
low complexity region 142 155 N/A INTRINSIC
Pfam:GTP_EFTU 256 521 1.7e-48 PFAM
Pfam:GTP_EFTU_D3 572 681 9.2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218108
Predicted Effect probably benign
Transcript: ENSMUST00000218714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219345
Predicted Effect possibly damaging
Transcript: ENSMUST00000219915
AA Change: D312E

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.7771 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding elongation factor family. It is expressed in multiple tissues with the highest expression in heart and skeletal muscle. The intergenic region of this gene and the MYB gene has been identified to be a quantitative trait locus (QTL) controlling fetal hemoglobin level, and this region influnces erythrocyte, platelet, and monocyte counts as well as erythrocyte volume and hemoglobin content. DNA polymorphisms at this region associate with fetal hemoglobin levels and pain crises in sickle cell disease. A single nucleotide polymorphism in exon 1 of this gene is significantly associated with severity in beta-thalassemia/Hemoglobin E. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,046,252 T4707I probably damaging Het
5730522E02Rik T A 11: 25,769,092 Y17F unknown Het
Aars2 A G 17: 45,514,550 D313G probably damaging Het
Abca9 A T 11: 110,115,447 D1277E probably benign Het
Adgrl1 G T 8: 83,934,901 A981S probably damaging Het
Aff3 T G 1: 38,204,940 K917Q possibly damaging Het
BC049715 A T 6: 136,839,996 H78L probably benign Het
Cacna1g C A 11: 94,411,054 A2027S possibly damaging Het
Camk1g G A 1: 193,356,401 probably benign Het
Carf T C 1: 60,144,002 V386A probably damaging Het
Cd46 A G 1: 195,086,164 S82P probably benign Het
Clic5 A G 17: 44,270,623 E180G possibly damaging Het
Col27a1 A G 4: 63,225,661 T529A probably benign Het
Col7a1 C T 9: 108,980,237 R2627C unknown Het
Cuzd1 G A 7: 131,311,908 probably benign Het
Cwc27 T C 13: 104,807,823 D50G possibly damaging Het
Dhx38 A G 8: 109,555,181 V735A possibly damaging Het
Dhx57 T G 17: 80,258,121 E834A probably damaging Het
Dsg4 A G 18: 20,470,879 D801G probably damaging Het
Dtx1 T C 5: 120,681,399 E578G probably damaging Het
F830016B08Rik A T 18: 60,300,193 H116L probably damaging Het
Fam208b A G 13: 3,596,842 V61A possibly damaging Het
Fbxw18 T C 9: 109,688,839 I360V possibly damaging Het
Fignl2 G A 15: 101,054,093 P103S probably benign Het
Frmpd1 A G 4: 45,284,196 T1006A probably benign Het
Ggnbp2 G T 11: 84,836,374 C545* probably null Het
Gm3336 A G 8: 70,718,645 probably benign Het
Gpr37 T C 6: 25,669,291 N518S probably benign Het
Hoxd10 C A 2: 74,692,720 S247R probably benign Het
Ifnb1 A T 4: 88,522,744 F11I probably benign Het
Marf1 T C 16: 14,151,320 probably benign Het
Myo1f T A 17: 33,601,956 V879E probably benign Het
Naip1 A G 13: 100,409,148 F1291L probably benign Het
Nckap1l A G 15: 103,474,159 E529G probably damaging Het
Npm3 T C 19: 45,748,229 E157G probably damaging Het
Olfr1200 T A 2: 88,767,641 T225S possibly damaging Het
Olfr1240 G T 2: 89,439,396 N294K probably benign Het
Olfr248 A G 1: 174,391,209 T47A probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Ppp6r1 A G 7: 4,633,287 V768A probably benign Het
Prrc1 A G 18: 57,362,492 T14A probably damaging Het
Ranbp2 T C 10: 58,477,283 L1275P probably damaging Het
Rnf214 C A 9: 45,899,823 V181F probably damaging Het
Ror2 T C 13: 53,132,004 N58S probably damaging Het
Selplg G A 5: 113,820,008 T79I probably damaging Het
Setd1b G A 5: 123,157,437 G1023S unknown Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Skint5 A G 4: 113,705,596 V803A unknown Het
Slc25a46 T C 18: 31,583,266 I394M possibly damaging Het
Snrnp27 A T 6: 86,680,953 I101K possibly damaging Het
Spag17 C A 3: 100,027,590 T704K probably benign Het
Tas2r144 T A 6: 42,216,124 M266K possibly damaging Het
Tbc1d31 T A 15: 57,955,350 L783H probably benign Het
Tbck C A 3: 132,751,232 probably benign Het
Vcan A G 13: 89,691,275 V2050A probably damaging Het
Vmn1r70 T A 7: 10,634,060 N158K probably damaging Het
Vmn2r103 T A 17: 19,792,859 Y81N probably benign Het
Vmn2r103 A G 17: 19,793,464 T173A probably benign Het
Ylpm1 T G 12: 85,014,980 S552A unknown Het
Zdhhc17 A T 10: 110,982,106 Y58* probably null Het
Other mutations in Hbs1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Hbs1l APN 10 21307756 missense probably benign 0.03
IGL02948:Hbs1l APN 10 21341711 splice site probably benign
R0465:Hbs1l UTSW 10 21352041 missense probably null 0.85
R0555:Hbs1l UTSW 10 21349323 missense probably benign 0.14
R0909:Hbs1l UTSW 10 21307738 missense probably benign 0.00
R1172:Hbs1l UTSW 10 21304638 missense probably damaging 1.00
R1594:Hbs1l UTSW 10 21352023 missense probably benign 0.00
R1612:Hbs1l UTSW 10 21358835 missense probably damaging 1.00
R1869:Hbs1l UTSW 10 21358406 splice site probably null
R2109:Hbs1l UTSW 10 21341932 nonsense probably null
R2369:Hbs1l UTSW 10 21307745 missense probably benign 0.01
R2404:Hbs1l UTSW 10 21296047 start gained probably benign
R4077:Hbs1l UTSW 10 21352602 missense probably damaging 1.00
R4079:Hbs1l UTSW 10 21352602 missense probably damaging 1.00
R4534:Hbs1l UTSW 10 21341915 missense possibly damaging 0.74
R4796:Hbs1l UTSW 10 21342506 missense probably damaging 1.00
R4852:Hbs1l UTSW 10 21358388 missense possibly damaging 0.92
R5069:Hbs1l UTSW 10 21354647 missense probably damaging 1.00
R5946:Hbs1l UTSW 10 21341756 missense probably benign
R6232:Hbs1l UTSW 10 21307758 splice site probably null
R6264:Hbs1l UTSW 10 21367757 missense possibly damaging 0.92
R6542:Hbs1l UTSW 10 21304617 missense probably benign 0.11
R6831:Hbs1l UTSW 10 21341868 missense probably benign 0.29
R7295:Hbs1l UTSW 10 21310152 missense probably benign 0.12
R7470:Hbs1l UTSW 10 21358784 missense possibly damaging 0.96
R7652:Hbs1l UTSW 10 21364760 missense probably benign 0.02
R7695:Hbs1l UTSW 10 21299217 missense possibly damaging 0.49
R7909:Hbs1l UTSW 10 21358404 critical splice donor site probably null
R8325:Hbs1l UTSW 10 21307649 missense probably benign 0.02
R8353:Hbs1l UTSW 10 21309279 missense probably benign
R8453:Hbs1l UTSW 10 21309279 missense probably benign
R8878:Hbs1l UTSW 10 21358812 missense possibly damaging 0.47
R8880:Hbs1l UTSW 10 21309969 missense probably damaging 0.99
X0018:Hbs1l UTSW 10 21351987 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAATGCCTCAATGTGAGCATCTG -3'
(R):5'- ATATGCCGAGGGAGCAACAACTGC -3'

Sequencing Primer
(F):5'- GCCTCAATGTGAGCATCTGAAATG -3'
(R):5'- GTCCAGCACTGCTGTCTG -3'
Posted On2013-04-24