Mutagenetix > Incidental Mutation

Incidental Mutation 'R0375:Hbs1l'

30698

Institutional Source

Beutler Lab

Gene Symbol

Hbs1l

Ensembl Gene

ENSMUSG00000019977

Gene Name

Hbs1-like (S. cerevisiae)

Synonyms

2810035F15Rik, eRFS

MMRRC Submission

038581-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0375 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21295979-21368898 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21342541 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 312 (D312E)

Ref Sequence

ENSEMBL: ENSMUSP00000151689 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020153] [ENSMUST00000218714] [ENSMUST00000219915]

AlphaFold

Q69ZS7

Predicted Effect

probably benign
Transcript: ENSMUST00000020153
AA Change: D309E

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000020153
Gene: ENSMUSG00000019977
AA Change: D309E

Domain	Start	End	E-Value	Type
Pfam:HBS1_N	33	125	1e-22	PFAM
low complexity region	142	155	N/A	INTRINSIC
Pfam:GTP_EFTU	256	521	1.7e-48	PFAM
Pfam:GTP_EFTU_D3	572	681	9.2e-34	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218108

Predicted Effect

probably benign
Transcript: ENSMUST00000218714

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219345

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219915
AA Change: D312E

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)

Meta Mutation Damage Score

0.7771

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding elongation factor family. It is expressed in multiple tissues with the highest expression in heart and skeletal muscle. The intergenic region of this gene and the MYB gene has been identified to be a quantitative trait locus (QTL) controlling fetal hemoglobin level, and this region influnces erythrocyte, platelet, and monocyte counts as well as erythrocyte volume and hemoglobin content. DNA polymorphisms at this region associate with fetal hemoglobin levels and pain crises in sickle cell disease. A single nucleotide polymorphism in exon 1 of this gene is significantly associated with severity in beta-thalassemia/Hemoglobin E. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, May 2009]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,046,252	T4707I	probably damaging	Het
5730522E02Rik	T	A	11: 25,769,092	Y17F	unknown	Het
Aars2	A	G	17: 45,514,550	D313G	probably damaging	Het
Abca9	A	T	11: 110,115,447	D1277E	probably benign	Het
Adgrl1	G	T	8: 83,934,901	A981S	probably damaging	Het
Aff3	T	G	1: 38,204,940	K917Q	possibly damaging	Het
BC049715	A	T	6: 136,839,996	H78L	probably benign	Het
Cacna1g	C	A	11: 94,411,054	A2027S	possibly damaging	Het
Camk1g	G	A	1: 193,356,401		probably benign	Het
Carf	T	C	1: 60,144,002	V386A	probably damaging	Het
Cd46	A	G	1: 195,086,164	S82P	probably benign	Het
Clic5	A	G	17: 44,270,623	E180G	possibly damaging	Het
Col27a1	A	G	4: 63,225,661	T529A	probably benign	Het
Col7a1	C	T	9: 108,980,237	R2627C	unknown	Het
Cuzd1	G	A	7: 131,311,908		probably benign	Het
Cwc27	T	C	13: 104,807,823	D50G	possibly damaging	Het
Dhx38	A	G	8: 109,555,181	V735A	possibly damaging	Het
Dhx57	T	G	17: 80,258,121	E834A	probably damaging	Het
Dsg4	A	G	18: 20,470,879	D801G	probably damaging	Het
Dtx1	T	C	5: 120,681,399	E578G	probably damaging	Het
F830016B08Rik	A	T	18: 60,300,193	H116L	probably damaging	Het
Fam208b	A	G	13: 3,596,842	V61A	possibly damaging	Het
Fbxw18	T	C	9: 109,688,839	I360V	possibly damaging	Het
Fignl2	G	A	15: 101,054,093	P103S	probably benign	Het
Frmpd1	A	G	4: 45,284,196	T1006A	probably benign	Het
Ggnbp2	G	T	11: 84,836,374	C545*	probably null	Het
Gm3336	A	G	8: 70,718,645		probably benign	Het
Gpr37	T	C	6: 25,669,291	N518S	probably benign	Het
Hoxd10	C	A	2: 74,692,720	S247R	probably benign	Het
Ifnb1	A	T	4: 88,522,744	F11I	probably benign	Het
Marf1	T	C	16: 14,151,320		probably benign	Het
Myo1f	T	A	17: 33,601,956	V879E	probably benign	Het
Naip1	A	G	13: 100,409,148	F1291L	probably benign	Het
Nckap1l	A	G	15: 103,474,159	E529G	probably damaging	Het
Npm3	T	C	19: 45,748,229	E157G	probably damaging	Het
Olfr1200	T	A	2: 88,767,641	T225S	possibly damaging	Het
Olfr1240	G	T	2: 89,439,396	N294K	probably benign	Het
Olfr248	A	G	1: 174,391,209	T47A	probably damaging	Het
Pex16	G	A	2: 92,380,457	G312D	probably damaging	Het
Ppp6r1	A	G	7: 4,633,287	V768A	probably benign	Het
Prrc1	A	G	18: 57,362,492	T14A	probably damaging	Het
Ranbp2	T	C	10: 58,477,283	L1275P	probably damaging	Het
Rnf214	C	A	9: 45,899,823	V181F	probably damaging	Het
Ror2	T	C	13: 53,132,004	N58S	probably damaging	Het
Selplg	G	A	5: 113,820,008	T79I	probably damaging	Het
Setd1b	G	A	5: 123,157,437	G1023S	unknown	Het
Sf3b2	C	T	19: 5,274,824	D845N	probably damaging	Het
Skint5	A	G	4: 113,705,596	V803A	unknown	Het
Slc25a46	T	C	18: 31,583,266	I394M	possibly damaging	Het
Snrnp27	A	T	6: 86,680,953	I101K	possibly damaging	Het
Spag17	C	A	3: 100,027,590	T704K	probably benign	Het
Tas2r144	T	A	6: 42,216,124	M266K	possibly damaging	Het
Tbc1d31	T	A	15: 57,955,350	L783H	probably benign	Het
Tbck	C	A	3: 132,751,232		probably benign	Het
Vcan	A	G	13: 89,691,275	V2050A	probably damaging	Het
Vmn1r70	T	A	7: 10,634,060	N158K	probably damaging	Het
Vmn2r103	T	A	17: 19,792,859	Y81N	probably benign	Het
Vmn2r103	A	G	17: 19,793,464	T173A	probably benign	Het
Ylpm1	T	G	12: 85,014,980	S552A	unknown	Het
Zdhhc17	A	T	10: 110,982,106	Y58*	probably null	Het

Other mutations in Hbs1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01542:Hbs1l	APN	10	21307756	missense	probably benign	0.03
IGL02948:Hbs1l	APN	10	21341711	splice site	probably benign
R0465:Hbs1l	UTSW	10	21352041	missense	probably null	0.85
R0555:Hbs1l	UTSW	10	21349323	missense	probably benign	0.14
R0909:Hbs1l	UTSW	10	21307738	missense	probably benign	0.00
R1172:Hbs1l	UTSW	10	21304638	missense	probably damaging	1.00
R1594:Hbs1l	UTSW	10	21352023	missense	probably benign	0.00
R1612:Hbs1l	UTSW	10	21358835	missense	probably damaging	1.00
R1869:Hbs1l	UTSW	10	21358406	splice site	probably null
R2109:Hbs1l	UTSW	10	21341932	nonsense	probably null
R2369:Hbs1l	UTSW	10	21307745	missense	probably benign	0.01
R2404:Hbs1l	UTSW	10	21296047	start gained	probably benign
R4077:Hbs1l	UTSW	10	21352602	missense	probably damaging	1.00
R4079:Hbs1l	UTSW	10	21352602	missense	probably damaging	1.00
R4534:Hbs1l	UTSW	10	21341915	missense	possibly damaging	0.74
R4796:Hbs1l	UTSW	10	21342506	missense	probably damaging	1.00
R4852:Hbs1l	UTSW	10	21358388	missense	possibly damaging	0.92
R5069:Hbs1l	UTSW	10	21354647	missense	probably damaging	1.00
R5946:Hbs1l	UTSW	10	21341756	missense	probably benign
R6232:Hbs1l	UTSW	10	21307758	splice site	probably null
R6264:Hbs1l	UTSW	10	21367757	missense	possibly damaging	0.92
R6542:Hbs1l	UTSW	10	21304617	missense	probably benign	0.11
R6831:Hbs1l	UTSW	10	21341868	missense	probably benign	0.29
R7295:Hbs1l	UTSW	10	21310152	missense	probably benign	0.12
R7470:Hbs1l	UTSW	10	21358784	missense	possibly damaging	0.96
R7652:Hbs1l	UTSW	10	21364760	missense	probably benign	0.02
R7695:Hbs1l	UTSW	10	21299217	missense	possibly damaging	0.49
R7909:Hbs1l	UTSW	10	21358404	critical splice donor site	probably null
R8325:Hbs1l	UTSW	10	21307649	missense	probably benign	0.02
R8353:Hbs1l	UTSW	10	21309279	missense	probably benign
R8453:Hbs1l	UTSW	10	21309279	missense	probably benign
R8861:Hbs1l	UTSW	10	21345064	splice site	probably benign
R8878:Hbs1l	UTSW	10	21358812	missense	possibly damaging	0.47
R8880:Hbs1l	UTSW	10	21309969	missense	probably damaging	0.99
R8933:Hbs1l	UTSW	10	21367685	nonsense	probably null
R9462:Hbs1l	UTSW	10	21342405	missense	probably damaging	1.00
R9654:Hbs1l	UTSW	10	21307705	missense	possibly damaging	0.95
X0018:Hbs1l	UTSW	10	21351987	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCAATGCCTCAATGTGAGCATCTG -3'
(R):5'- ATATGCCGAGGGAGCAACAACTGC -3'

Sequencing Primer
(F):5'- GCCTCAATGTGAGCATCTGAAATG -3'
(R):5'- GTCCAGCACTGCTGTCTG -3'

Posted On

2013-04-24