Incidental Mutation 'R3922:Olfr615'
ID306980
Institutional Source Beutler Lab
Gene Symbol Olfr615
Ensembl Gene ENSMUSG00000073947
Gene Nameolfactory receptor 615
SynonymsGA_x6K02T2PBJ9-6284902-6285843, MOR19-2
MMRRC Submission 040819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3922 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103556079-103563798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103560705 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 76 (V76A)
Ref Sequence ENSEMBL: ENSMUSP00000150166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098198] [ENSMUST00000106886] [ENSMUST00000214345] [ENSMUST00000214806] [ENSMUST00000215673] [ENSMUST00000217293]
Predicted Effect probably benign
Transcript: ENSMUST00000098198
AA Change: V76A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095800
Gene: ENSMUSG00000073947
AA Change: V76A

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.5e-105 PFAM
Pfam:7TM_GPCR_Srsx 36 253 8.5e-9 PFAM
Pfam:7tm_1 42 293 8.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106886
SMART Domains Protein: ENSMUSP00000102499
Gene: ENSMUSG00000047544

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:7tm_4 33 311 1.1e-116 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.2e-6 PFAM
Pfam:7tm_1 43 294 4.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214345
AA Change: V76A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000214806
Predicted Effect probably benign
Transcript: ENSMUST00000215673
AA Change: V76A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000217293
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4921504E06Rik T A 2: 19,480,560 E432V probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Arhgef28 A G 13: 97,993,944 L462P possibly damaging Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cep70 T A 9: 99,275,579 *117R probably null Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Cntrl A G 2: 35,129,739 E526G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Eea1 T A 10: 96,036,633 N1068K probably benign Het
Egfr T A 11: 16,881,495 C555S probably damaging Het
Esd A T 14: 74,743,227 Q130H probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Gpr89 A T 3: 96,890,899 I147N probably damaging Het
H2-M10.1 T A 17: 36,325,685 I76L probably benign Het
Lgi4 A T 7: 31,067,448 D300V probably benign Het
Lrp1b C A 2: 40,677,581 V276L unknown Het
Lrp2 T C 2: 69,506,376 K1351E probably benign Het
Mroh8 T C 2: 157,222,811 I782V probably benign Het
Msrb1 T C 17: 24,740,083 S70P probably damaging Het
Nek10 T C 14: 14,861,585 M547T possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Olfr769 C A 10: 129,111,613 V271F possibly damaging Het
P4htm T C 9: 108,582,895 N227D probably benign Het
Plekhm2 T C 4: 141,629,532 T787A probably benign Het
Pramel5 A G 4: 144,273,052 L155P probably damaging Het
Sbno1 T C 5: 124,381,930 Y1122C probably damaging Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Sft2d1 G T 17: 8,318,882 L34F possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc27a3 G T 3: 90,387,085 H460N possibly damaging Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Ssh1 T G 5: 113,942,708 Q865P possibly damaging Het
Trp63 A G 16: 25,889,009 D583G probably damaging Het
Usp28 T C 9: 49,030,923 probably null Het
Wdr43 A G 17: 71,638,301 probably benign Het
Zfhx4 A G 3: 5,400,647 Y1955C probably damaging Het
Zfp108 G A 7: 24,261,348 G455R probably damaging Het
Zfp353-ps A T 8: 42,083,012 noncoding transcript Het
Other mutations in Olfr615
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Olfr615 APN 7 103561356 missense probably damaging 1.00
IGL01310:Olfr615 APN 7 103560801 missense probably benign
IGL01597:Olfr615 APN 7 103561142 missense possibly damaging 0.79
IGL01725:Olfr615 APN 7 103561075 nonsense probably null
IGL03291:Olfr615 APN 7 103560912 missense possibly damaging 0.93
R0055:Olfr615 UTSW 7 103561037 missense probably damaging 1.00
R0055:Olfr615 UTSW 7 103561037 missense probably damaging 1.00
R0189:Olfr615 UTSW 7 103561082 missense probably benign 0.01
R0254:Olfr615 UTSW 7 103560622 nonsense probably null
R1395:Olfr615 UTSW 7 103561119 missense possibly damaging 0.92
R1781:Olfr615 UTSW 7 103560566 missense probably benign 0.34
R2866:Olfr615 UTSW 7 103560857 missense probably damaging 1.00
R2958:Olfr615 UTSW 7 103561305 missense possibly damaging 0.54
R4306:Olfr615 UTSW 7 103561172 nonsense probably null
R4306:Olfr615 UTSW 7 103561173 missense possibly damaging 0.50
R4818:Olfr615 UTSW 7 103560761 missense probably benign 0.07
R4907:Olfr615 UTSW 7 103561034 missense possibly damaging 0.85
R4993:Olfr615 UTSW 7 103561317 missense possibly damaging 0.63
R5461:Olfr615 UTSW 7 103560573 missense probably damaging 1.00
R6225:Olfr615 UTSW 7 103561282 missense probably benign 0.01
R6621:Olfr615 UTSW 7 103560878 missense possibly damaging 0.93
R7174:Olfr615 UTSW 7 103561391 nonsense probably null
R7665:Olfr615 UTSW 7 103561316 missense probably benign 0.00
R7684:Olfr615 UTSW 7 103561218 missense probably benign 0.01
Z1088:Olfr615 UTSW 7 103561059 missense probably benign
Z1088:Olfr615 UTSW 7 103561390 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCATCCTCACTGGCCTCAGAG -3'
(R):5'- CCTCAGAAAAGCTGCCAGTC -3'

Sequencing Primer
(F):5'- CCTCAGAGGGCTGGTGG -3'
(R):5'- CATCCTGGTGACTCGTGAG -3'
Posted On2015-04-17