Incidental Mutation 'R3922:Usp28'
ID306982
Institutional Source Beutler Lab
Gene Symbol Usp28
Ensembl Gene ENSMUSG00000032267
Gene Nameubiquitin specific peptidase 28
Synonyms9830148O20Rik
MMRRC Submission 040819-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3922 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location48985375-49042517 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 49030923 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047349] [ENSMUST00000047349] [ENSMUST00000213874] [ENSMUST00000213874] [ENSMUST00000215856] [ENSMUST00000215856]
Predicted Effect probably null
Transcript: ENSMUST00000047349
SMART Domains Protein: ENSMUSP00000047467
Gene: ENSMUSG00000032267

DomainStartEndE-ValueType
UIM 97 116 3.1e-3 SMART
Pfam:UCH 161 652 5.4e-52 PFAM
Pfam:UCH_1 162 626 2e-11 PFAM
low complexity region 695 705 N/A INTRINSIC
low complexity region 713 730 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000047349
SMART Domains Protein: ENSMUSP00000047467
Gene: ENSMUSG00000032267

DomainStartEndE-ValueType
UIM 97 116 3.1e-3 SMART
Pfam:UCH 161 652 5.4e-52 PFAM
Pfam:UCH_1 162 626 2e-11 PFAM
low complexity region 695 705 N/A INTRINSIC
low complexity region 713 730 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213457
Predicted Effect probably null
Transcript: ENSMUST00000213874
Predicted Effect probably null
Transcript: ENSMUST00000213874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215118
Predicted Effect probably null
Transcript: ENSMUST00000215856
Predicted Effect probably null
Transcript: ENSMUST00000215856
Meta Mutation Damage Score 0.9593 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitinase involved in the DNA damage pathway and DNA damage-induced apoptosis. Overexpression of this gene is seen in several cancers. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit slightly decreased spleen weight and splenocyte number but show neither major signaling defects in DNA damage response nor developmental defects indicative of impaired double-strand break metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4921504E06Rik T A 2: 19,480,560 E432V probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Arhgef28 A G 13: 97,993,944 L462P possibly damaging Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cep70 T A 9: 99,275,579 *117R probably null Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Cntrl A G 2: 35,129,739 E526G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Eea1 T A 10: 96,036,633 N1068K probably benign Het
Egfr T A 11: 16,881,495 C555S probably damaging Het
Esd A T 14: 74,743,227 Q130H probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Gpr89 A T 3: 96,890,899 I147N probably damaging Het
H2-M10.1 T A 17: 36,325,685 I76L probably benign Het
Lgi4 A T 7: 31,067,448 D300V probably benign Het
Lrp1b C A 2: 40,677,581 V276L unknown Het
Lrp2 T C 2: 69,506,376 K1351E probably benign Het
Mroh8 T C 2: 157,222,811 I782V probably benign Het
Msrb1 T C 17: 24,740,083 S70P probably damaging Het
Nek10 T C 14: 14,861,585 M547T possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Olfr615 T C 7: 103,560,705 V76A probably benign Het
Olfr769 C A 10: 129,111,613 V271F possibly damaging Het
P4htm T C 9: 108,582,895 N227D probably benign Het
Plekhm2 T C 4: 141,629,532 T787A probably benign Het
Pramel5 A G 4: 144,273,052 L155P probably damaging Het
Sbno1 T C 5: 124,381,930 Y1122C probably damaging Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Sft2d1 G T 17: 8,318,882 L34F possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc27a3 G T 3: 90,387,085 H460N possibly damaging Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Ssh1 T G 5: 113,942,708 Q865P possibly damaging Het
Trp63 A G 16: 25,889,009 D583G probably damaging Het
Wdr43 A G 17: 71,638,301 probably benign Het
Zfhx4 A G 3: 5,400,647 Y1955C probably damaging Het
Zfp108 G A 7: 24,261,348 G455R probably damaging Het
Zfp353-ps A T 8: 42,083,012 noncoding transcript Het
Other mutations in Usp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Usp28 APN 9 49028163 missense probably benign 0.01
IGL01105:Usp28 APN 9 49010250 missense probably damaging 1.00
IGL01124:Usp28 APN 9 49037213 missense probably damaging 1.00
IGL01304:Usp28 APN 9 49026819 missense probably damaging 0.99
IGL01527:Usp28 APN 9 49025873 missense probably benign 0.02
IGL01859:Usp28 APN 9 49024021 nonsense probably null
IGL01860:Usp28 APN 9 49032243 nonsense probably null
IGL02047:Usp28 APN 9 49035641 missense probably damaging 0.99
IGL02188:Usp28 APN 9 49024009 missense probably benign 0.00
IGL02267:Usp28 APN 9 49023965 missense probably damaging 1.00
IGL02472:Usp28 APN 9 49037769 missense possibly damaging 0.95
IGL02675:Usp28 APN 9 49039091 missense possibly damaging 0.81
IGL02982:Usp28 APN 9 49018439 missense probably benign 0.00
IGL03105:Usp28 APN 9 49039055 missense probably damaging 0.99
R0100:Usp28 UTSW 9 49035932 missense probably damaging 1.00
R0114:Usp28 UTSW 9 49039023 missense probably benign 0.00
R0196:Usp28 UTSW 9 49028278 missense probably damaging 0.96
R0206:Usp28 UTSW 9 49028269 missense probably damaging 1.00
R0349:Usp28 UTSW 9 49010281 nonsense probably null
R0379:Usp28 UTSW 9 49024067 missense possibly damaging 0.58
R0454:Usp28 UTSW 9 49039101 missense possibly damaging 0.94
R0479:Usp28 UTSW 9 49037213 missense probably damaging 1.00
R0540:Usp28 UTSW 9 49024060 missense probably benign
R0726:Usp28 UTSW 9 49003869 missense probably damaging 1.00
R0835:Usp28 UTSW 9 49001524 missense probably damaging 1.00
R0928:Usp28 UTSW 9 49030891 missense possibly damaging 0.60
R1271:Usp28 UTSW 9 49035961 critical splice donor site probably null
R1534:Usp28 UTSW 9 48985506 missense possibly damaging 0.92
R1539:Usp28 UTSW 9 49037796 missense probably benign 0.07
R1687:Usp28 UTSW 9 49024017 missense probably benign 0.00
R1867:Usp28 UTSW 9 49009194 missense probably benign 0.00
R1868:Usp28 UTSW 9 49016707 missense probably damaging 1.00
R1884:Usp28 UTSW 9 49035947 missense probably damaging 1.00
R2029:Usp28 UTSW 9 48985503 missense probably benign 0.22
R2046:Usp28 UTSW 9 49039075 missense probably damaging 1.00
R2379:Usp28 UTSW 9 49003095 missense probably null 0.94
R2404:Usp28 UTSW 9 49037258 critical splice donor site probably null
R3196:Usp28 UTSW 9 49025825 missense probably benign 0.03
R3831:Usp28 UTSW 9 49035638 missense probably benign 0.00
R3924:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3926:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3943:Usp28 UTSW 9 49000366 missense probably benign 0.12
R4834:Usp28 UTSW 9 49001536 missense probably damaging 1.00
R5041:Usp28 UTSW 9 49037773 missense probably benign
R5186:Usp28 UTSW 9 49010250 missense probably damaging 1.00
R5308:Usp28 UTSW 9 49037201 missense probably damaging 1.00
R5870:Usp28 UTSW 9 49025985 nonsense probably null
R6838:Usp28 UTSW 9 49000430 critical splice donor site probably null
R6959:Usp28 UTSW 9 49001542 missense probably damaging 1.00
R7058:Usp28 UTSW 9 49039156 missense probably damaging 1.00
R7348:Usp28 UTSW 9 49030877 missense probably benign 0.19
R7766:Usp28 UTSW 9 49035883 missense probably damaging 1.00
R7814:Usp28 UTSW 9 49003918 missense probably benign 0.01
R7828:Usp28 UTSW 9 49003902 missense possibly damaging 0.95
R8167:Usp28 UTSW 9 49037848 missense probably damaging 0.99
R8273:Usp28 UTSW 9 49026882 missense probably damaging 1.00
Z1176:Usp28 UTSW 9 49035925 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAATCTGATGAGACTGCAGG -3'
(R):5'- CTGTAGGACAGCCACTATAAACAG -3'

Sequencing Primer
(F):5'- GAGAAGTGGAAGCCCTGTCTGTG -3'
(R):5'- AACTGGCCCTGACAAGTTG -3'
Posted On2015-04-17