Incidental Mutation 'R3922:Cep70'
ID306983
Institutional Source Beutler Lab
Gene Symbol Cep70
Ensembl Gene ENSMUSG00000056267
Gene Namecentrosomal protein 70
SynonymsC030018L16Rik, 6720484E09Rik
MMRRC Submission 040819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R3922 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location99243367-99300404 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 99275579 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 117 (*117R)
Ref Sequence ENSEMBL: ENSMUSP00000139896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093795] [ENSMUST00000191014] [ENSMUST00000191335]
Predicted Effect probably benign
Transcript: ENSMUST00000093795
AA Change: M177K

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000091312
Gene: ENSMUSG00000056267
AA Change: M177K

DomainStartEndE-ValueType
coiled coil region 96 210 N/A INTRINSIC
coiled coil region 278 299 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000191014
AA Change: *117R
Predicted Effect probably benign
Transcript: ENSMUST00000191335
AA Change: M177K

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000139816
Gene: ENSMUSG00000056267
AA Change: M177K

DomainStartEndE-ValueType
coiled coil region 96 210 N/A INTRINSIC
coiled coil region 278 299 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4921504E06Rik T A 2: 19,480,560 E432V probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Arhgef28 A G 13: 97,993,944 L462P possibly damaging Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Cntrl A G 2: 35,129,739 E526G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Eea1 T A 10: 96,036,633 N1068K probably benign Het
Egfr T A 11: 16,881,495 C555S probably damaging Het
Esd A T 14: 74,743,227 Q130H probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Gpr89 A T 3: 96,890,899 I147N probably damaging Het
H2-M10.1 T A 17: 36,325,685 I76L probably benign Het
Lgi4 A T 7: 31,067,448 D300V probably benign Het
Lrp1b C A 2: 40,677,581 V276L unknown Het
Lrp2 T C 2: 69,506,376 K1351E probably benign Het
Mroh8 T C 2: 157,222,811 I782V probably benign Het
Msrb1 T C 17: 24,740,083 S70P probably damaging Het
Nek10 T C 14: 14,861,585 M547T possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Olfr615 T C 7: 103,560,705 V76A probably benign Het
Olfr769 C A 10: 129,111,613 V271F possibly damaging Het
P4htm T C 9: 108,582,895 N227D probably benign Het
Plekhm2 T C 4: 141,629,532 T787A probably benign Het
Pramel5 A G 4: 144,273,052 L155P probably damaging Het
Sbno1 T C 5: 124,381,930 Y1122C probably damaging Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Sft2d1 G T 17: 8,318,882 L34F possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc27a3 G T 3: 90,387,085 H460N possibly damaging Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Ssh1 T G 5: 113,942,708 Q865P possibly damaging Het
Trp63 A G 16: 25,889,009 D583G probably damaging Het
Usp28 T C 9: 49,030,923 probably null Het
Wdr43 A G 17: 71,638,301 probably benign Het
Zfhx4 A G 3: 5,400,647 Y1955C probably damaging Het
Zfp108 G A 7: 24,261,348 G455R probably damaging Het
Zfp353-ps A T 8: 42,083,012 noncoding transcript Het
Other mutations in Cep70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Cep70 APN 9 99298500 unclassified probably benign
IGL02719:Cep70 APN 9 99275722 missense probably damaging 0.99
IGL02878:Cep70 APN 9 99281107 splice site probably benign
IGL02969:Cep70 APN 9 99298504 missense possibly damaging 0.88
R0426:Cep70 UTSW 9 99297684 missense probably benign 0.02
R0970:Cep70 UTSW 9 99275599 missense possibly damaging 0.93
R1238:Cep70 UTSW 9 99254265 missense probably benign 0.05
R1462:Cep70 UTSW 9 99263720 missense probably benign 0.20
R1462:Cep70 UTSW 9 99263720 missense probably benign 0.20
R2141:Cep70 UTSW 9 99296385 missense probably damaging 1.00
R3964:Cep70 UTSW 9 99298534 missense probably damaging 1.00
R3965:Cep70 UTSW 9 99298534 missense probably damaging 1.00
R4044:Cep70 UTSW 9 99262609 missense possibly damaging 0.66
R4174:Cep70 UTSW 9 99246313 start gained probably benign
R4659:Cep70 UTSW 9 99296341 missense possibly damaging 0.86
R4672:Cep70 UTSW 9 99254312 missense possibly damaging 0.66
R4839:Cep70 UTSW 9 99296085 missense probably benign 0.16
R5108:Cep70 UTSW 9 99263812 splice site probably null
R5288:Cep70 UTSW 9 99281075 missense probably damaging 1.00
R5386:Cep70 UTSW 9 99281075 missense probably damaging 1.00
R5802:Cep70 UTSW 9 99296405 missense probably damaging 0.96
R5934:Cep70 UTSW 9 99254265 missense probably benign 0.05
R6076:Cep70 UTSW 9 99298505 missense probably damaging 1.00
R6848:Cep70 UTSW 9 99262901 missense probably benign 0.34
R6977:Cep70 UTSW 9 99291676 missense probably damaging 1.00
R7286:Cep70 UTSW 9 99275585 missense probably damaging 1.00
R7437:Cep70 UTSW 9 99291529 missense probably damaging 1.00
R7754:Cep70 UTSW 9 99281092 missense probably damaging 1.00
R7879:Cep70 UTSW 9 99262633 missense possibly damaging 0.54
R8063:Cep70 UTSW 9 99296122 missense probably benign 0.02
R8299:Cep70 UTSW 9 99262861 missense possibly damaging 0.95
R8466:Cep70 UTSW 9 99278020 critical splice donor site probably null
R8684:Cep70 UTSW 9 99263789 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AATGCATGCAGTCAACATAGTTCC -3'
(R):5'- GCTCCATTATCGTCTTATGTACTAGG -3'

Sequencing Primer
(F):5'- TGAAACAGCTCAGTGGAG -3'
(R):5'- GGCATTACTGTTTATCCAAGACTGAG -3'
Posted On2015-04-17