Incidental Mutation 'R3922:Slc35g2'
ID306984
Institutional Source Beutler Lab
Gene Symbol Slc35g2
Ensembl Gene ENSMUSG00000070287
Gene Namesolute carrier family 35, member G2
SynonymsLOC245020, Tmem22
MMRRC Submission 040819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R3922 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location100552188-100571090 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100552727 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 297 (I297N)
Ref Sequence ENSEMBL: ENSMUSP00000091308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093792]
Predicted Effect probably benign
Transcript: ENSMUST00000093792
AA Change: I297N

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000091308
Gene: ENSMUSG00000070287
AA Change: I297N

DomainStartEndE-ValueType
Pfam:EamA 102 238 3.8e-12 PFAM
Pfam:EamA 255 390 5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189478
Meta Mutation Damage Score 0.2866 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4921504E06Rik T A 2: 19,480,560 E432V probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Arhgef28 A G 13: 97,993,944 L462P possibly damaging Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cep70 T A 9: 99,275,579 *117R probably null Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Cntrl A G 2: 35,129,739 E526G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Eea1 T A 10: 96,036,633 N1068K probably benign Het
Egfr T A 11: 16,881,495 C555S probably damaging Het
Esd A T 14: 74,743,227 Q130H probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Gpr89 A T 3: 96,890,899 I147N probably damaging Het
H2-M10.1 T A 17: 36,325,685 I76L probably benign Het
Lgi4 A T 7: 31,067,448 D300V probably benign Het
Lrp1b C A 2: 40,677,581 V276L unknown Het
Lrp2 T C 2: 69,506,376 K1351E probably benign Het
Mroh8 T C 2: 157,222,811 I782V probably benign Het
Msrb1 T C 17: 24,740,083 S70P probably damaging Het
Nek10 T C 14: 14,861,585 M547T possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Olfr615 T C 7: 103,560,705 V76A probably benign Het
Olfr769 C A 10: 129,111,613 V271F possibly damaging Het
P4htm T C 9: 108,582,895 N227D probably benign Het
Plekhm2 T C 4: 141,629,532 T787A probably benign Het
Pramel5 A G 4: 144,273,052 L155P probably damaging Het
Sbno1 T C 5: 124,381,930 Y1122C probably damaging Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Sft2d1 G T 17: 8,318,882 L34F possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc27a3 G T 3: 90,387,085 H460N possibly damaging Het
Ssh1 T G 5: 113,942,708 Q865P possibly damaging Het
Trp63 A G 16: 25,889,009 D583G probably damaging Het
Usp28 T C 9: 49,030,923 probably null Het
Wdr43 A G 17: 71,638,301 probably benign Het
Zfhx4 A G 3: 5,400,647 Y1955C probably damaging Het
Zfp108 G A 7: 24,261,348 G455R probably damaging Het
Zfp353-ps A T 8: 42,083,012 noncoding transcript Het
Other mutations in Slc35g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Slc35g2 APN 9 100552463 missense probably damaging 1.00
IGL03264:Slc35g2 APN 9 100552646 missense possibly damaging 0.93
R0127:Slc35g2 UTSW 9 100553117 missense probably benign 0.12
R0626:Slc35g2 UTSW 9 100553442 missense probably benign 0.00
R1123:Slc35g2 UTSW 9 100552994 missense probably damaging 0.98
R2012:Slc35g2 UTSW 9 100553067 missense possibly damaging 0.88
R2057:Slc35g2 UTSW 9 100553276 missense probably damaging 1.00
R3924:Slc35g2 UTSW 9 100552727 missense probably benign 0.20
R4561:Slc35g2 UTSW 9 100553234 missense probably damaging 1.00
R4731:Slc35g2 UTSW 9 100552502 missense probably benign 0.20
R4732:Slc35g2 UTSW 9 100552502 missense probably benign 0.20
R4733:Slc35g2 UTSW 9 100552502 missense probably benign 0.20
R4760:Slc35g2 UTSW 9 100553496 missense probably benign 0.22
X0020:Slc35g2 UTSW 9 100553016 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CAATCTCCAAATGTTGTACTGTGC -3'
(R):5'- ATGGCTACAGTGGTTTGCAGC -3'

Sequencing Primer
(F):5'- GTACTGTGCTAACCAAAGCTG -3'
(R):5'- CTACAGTGGTTTGCAGCATCTTAG -3'
Posted On2015-04-17