Incidental Mutation 'R3922:Olfr769'
ID306988
Institutional Source Beutler Lab
Gene Symbol Olfr769
Ensembl Gene ENSMUSG00000042801
Gene Nameolfactory receptor 769
SynonymsGA_x6K02T2PULF-10797876-10796938, MOR114-14
MMRRC Submission 040819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R3922 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129108952-129117861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 129111613 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 271 (V271F)
Ref Sequence ENSEMBL: ENSMUSP00000149008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050915] [ENSMUST00000215453] [ENSMUST00000216906]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050915
AA Change: V271F

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000059078
Gene: ENSMUSG00000042801
AA Change: V271F

DomainStartEndE-ValueType
Pfam:7tm_4 29 309 1.2e-47 PFAM
Pfam:7tm_1 39 288 4.9e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215453
AA Change: V271F

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216906
AA Change: V271F

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4921504E06Rik T A 2: 19,480,560 E432V probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Arhgef28 A G 13: 97,993,944 L462P possibly damaging Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cep70 T A 9: 99,275,579 *117R probably null Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Cntrl A G 2: 35,129,739 E526G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Eea1 T A 10: 96,036,633 N1068K probably benign Het
Egfr T A 11: 16,881,495 C555S probably damaging Het
Esd A T 14: 74,743,227 Q130H probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Gpr89 A T 3: 96,890,899 I147N probably damaging Het
H2-M10.1 T A 17: 36,325,685 I76L probably benign Het
Lgi4 A T 7: 31,067,448 D300V probably benign Het
Lrp1b C A 2: 40,677,581 V276L unknown Het
Lrp2 T C 2: 69,506,376 K1351E probably benign Het
Mroh8 T C 2: 157,222,811 I782V probably benign Het
Msrb1 T C 17: 24,740,083 S70P probably damaging Het
Nek10 T C 14: 14,861,585 M547T possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Olfr615 T C 7: 103,560,705 V76A probably benign Het
P4htm T C 9: 108,582,895 N227D probably benign Het
Plekhm2 T C 4: 141,629,532 T787A probably benign Het
Pramel5 A G 4: 144,273,052 L155P probably damaging Het
Sbno1 T C 5: 124,381,930 Y1122C probably damaging Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Sft2d1 G T 17: 8,318,882 L34F possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc27a3 G T 3: 90,387,085 H460N possibly damaging Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Ssh1 T G 5: 113,942,708 Q865P possibly damaging Het
Trp63 A G 16: 25,889,009 D583G probably damaging Het
Usp28 T C 9: 49,030,923 probably null Het
Wdr43 A G 17: 71,638,301 probably benign Het
Zfhx4 A G 3: 5,400,647 Y1955C probably damaging Het
Zfp108 G A 7: 24,261,348 G455R probably damaging Het
Zfp353-ps A T 8: 42,083,012 noncoding transcript Het
Other mutations in Olfr769
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Olfr769 APN 10 129112024 missense probably benign 0.01
IGL02556:Olfr769 APN 10 129112035 missense probably damaging 1.00
IGL02699:Olfr769 APN 10 129111771 missense probably benign 0.00
R0503:Olfr769 UTSW 10 129111802 missense probably damaging 0.98
R0677:Olfr769 UTSW 10 129112078 missense probably damaging 1.00
R1697:Olfr769 UTSW 10 129111868 missense probably benign 0.01
R2992:Olfr769 UTSW 10 129111535 nonsense probably null
R7084:Olfr769 UTSW 10 129111547 nonsense probably null
R7301:Olfr769 UTSW 10 129111699 missense probably damaging 1.00
R7488:Olfr769 UTSW 10 129111736 missense probably benign 0.03
RF021:Olfr769 UTSW 10 129112342 missense probably damaging 0.99
Z1177:Olfr769 UTSW 10 129111946 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGTCAAGTCCATGGAGGGG -3'
(R):5'- TGACACTCATTATTACTCTGGTGTGTG -3'

Sequencing Primer
(F):5'- GATGCTGCTCATGGCGAATTAGAC -3'
(R):5'- GGTGTGTGTTGTTCTCTCCTACAC -3'
Posted On2015-04-17