Incidental Mutation 'R3922:Cdkl1'
ID306992
Institutional Source Beutler Lab
Gene Symbol Cdkl1
Ensembl Gene ENSMUSG00000020990
Gene Namecyclin-dependent kinase-like 1 (CDC2-related kinase)
Synonyms
MMRRC Submission 040819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R3922 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69746848-69791267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69756599 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 168 (R168S)
Ref Sequence ENSEMBL: ENSMUSP00000021377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021377]
Predicted Effect probably damaging
Transcript: ENSMUST00000021377
AA Change: R168S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021377
Gene: ENSMUSG00000020990
AA Change: R168S

DomainStartEndE-ValueType
S_TKc 4 287 5.27e-105 SMART
Meta Mutation Damage Score 0.5500 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a large family of CDC2-related serine/threonine protein kinases. It accumulates primarily in the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4921504E06Rik T A 2: 19,480,560 E432V probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Arhgef28 A G 13: 97,993,944 L462P possibly damaging Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Cep70 T A 9: 99,275,579 *117R probably null Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Cntrl A G 2: 35,129,739 E526G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Eea1 T A 10: 96,036,633 N1068K probably benign Het
Egfr T A 11: 16,881,495 C555S probably damaging Het
Esd A T 14: 74,743,227 Q130H probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Gpr89 A T 3: 96,890,899 I147N probably damaging Het
H2-M10.1 T A 17: 36,325,685 I76L probably benign Het
Lgi4 A T 7: 31,067,448 D300V probably benign Het
Lrp1b C A 2: 40,677,581 V276L unknown Het
Lrp2 T C 2: 69,506,376 K1351E probably benign Het
Mroh8 T C 2: 157,222,811 I782V probably benign Het
Msrb1 T C 17: 24,740,083 S70P probably damaging Het
Nek10 T C 14: 14,861,585 M547T possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Olfr615 T C 7: 103,560,705 V76A probably benign Het
Olfr769 C A 10: 129,111,613 V271F possibly damaging Het
P4htm T C 9: 108,582,895 N227D probably benign Het
Plekhm2 T C 4: 141,629,532 T787A probably benign Het
Pramel5 A G 4: 144,273,052 L155P probably damaging Het
Sbno1 T C 5: 124,381,930 Y1122C probably damaging Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Sft2d1 G T 17: 8,318,882 L34F possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc27a3 G T 3: 90,387,085 H460N possibly damaging Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Ssh1 T G 5: 113,942,708 Q865P possibly damaging Het
Trp63 A G 16: 25,889,009 D583G probably damaging Het
Usp28 T C 9: 49,030,923 probably null Het
Wdr43 A G 17: 71,638,301 probably benign Het
Zfhx4 A G 3: 5,400,647 Y1955C probably damaging Het
Zfp108 G A 7: 24,261,348 G455R probably damaging Het
Zfp353-ps A T 8: 42,083,012 noncoding transcript Het
Other mutations in Cdkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Cdkl1 APN 12 69750740 missense probably benign
IGL01859:Cdkl1 APN 12 69760129 missense probably damaging 1.00
R0218:Cdkl1 UTSW 12 69790035 missense probably benign 0.01
R0905:Cdkl1 UTSW 12 69756564 nonsense probably null
R3924:Cdkl1 UTSW 12 69756599 missense probably damaging 1.00
R3925:Cdkl1 UTSW 12 69756599 missense probably damaging 1.00
R5050:Cdkl1 UTSW 12 69757240 missense probably damaging 1.00
R5851:Cdkl1 UTSW 12 69756564 nonsense probably null
R7183:Cdkl1 UTSW 12 69748932 missense probably damaging 1.00
R7271:Cdkl1 UTSW 12 69748811 missense probably benign 0.10
R7461:Cdkl1 UTSW 12 69756461 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GTCAGCGGAAACCACTTACC -3'
(R):5'- AAGCCTGCTAATCTCCTGC -3'

Sequencing Primer
(F):5'- GGAAACCACTTACCCAGGGTTTTC -3'
(R):5'- CTTGGCTATAGATTAACACCCAAGG -3'
Posted On2015-04-17