Incidental Mutation 'R3922:Nek10'
ID306994
Institutional Source Beutler Lab
Gene Symbol Nek10
Ensembl Gene ENSMUSG00000042567
Gene NameNIMA (never in mitosis gene a)- related kinase 10
SynonymsLOC238944
MMRRC Submission 040819-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3922 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location14803415-15012059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14861585 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 547 (M547T)
Ref Sequence ENSEMBL: ENSMUSP00000108250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112630] [ENSMUST00000112631] [ENSMUST00000224491]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000063220
Predicted Effect possibly damaging
Transcript: ENSMUST00000112630
AA Change: M547T

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108249
Gene: ENSMUSG00000042567
AA Change: M547T

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112631
AA Change: M547T

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108250
Gene: ENSMUSG00000042567
AA Change: M547T

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134866
Predicted Effect possibly damaging
Transcript: ENSMUST00000224491
AA Change: M547T

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.4031 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4921504E06Rik T A 2: 19,480,560 E432V probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Arhgef28 A G 13: 97,993,944 L462P possibly damaging Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cep70 T A 9: 99,275,579 *117R probably null Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Cntrl A G 2: 35,129,739 E526G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Eea1 T A 10: 96,036,633 N1068K probably benign Het
Egfr T A 11: 16,881,495 C555S probably damaging Het
Esd A T 14: 74,743,227 Q130H probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Gpr89 A T 3: 96,890,899 I147N probably damaging Het
H2-M10.1 T A 17: 36,325,685 I76L probably benign Het
Lgi4 A T 7: 31,067,448 D300V probably benign Het
Lrp1b C A 2: 40,677,581 V276L unknown Het
Lrp2 T C 2: 69,506,376 K1351E probably benign Het
Mroh8 T C 2: 157,222,811 I782V probably benign Het
Msrb1 T C 17: 24,740,083 S70P probably damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Olfr615 T C 7: 103,560,705 V76A probably benign Het
Olfr769 C A 10: 129,111,613 V271F possibly damaging Het
P4htm T C 9: 108,582,895 N227D probably benign Het
Plekhm2 T C 4: 141,629,532 T787A probably benign Het
Pramel5 A G 4: 144,273,052 L155P probably damaging Het
Sbno1 T C 5: 124,381,930 Y1122C probably damaging Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Sft2d1 G T 17: 8,318,882 L34F possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc27a3 G T 3: 90,387,085 H460N possibly damaging Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Ssh1 T G 5: 113,942,708 Q865P possibly damaging Het
Trp63 A G 16: 25,889,009 D583G probably damaging Het
Usp28 T C 9: 49,030,923 probably null Het
Wdr43 A G 17: 71,638,301 probably benign Het
Zfhx4 A G 3: 5,400,647 Y1955C probably damaging Het
Zfp108 G A 7: 24,261,348 G455R probably damaging Het
Zfp353-ps A T 8: 42,083,012 noncoding transcript Het
Other mutations in Nek10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Nek10 APN 14 14850957 missense probably damaging 0.99
IGL02067:Nek10 APN 14 14861639 missense probably benign 0.12
IGL02361:Nek10 APN 14 14843856 missense probably damaging 1.00
IGL02687:Nek10 APN 14 14840570 missense probably damaging 1.00
IGL02929:Nek10 APN 14 14821119 missense possibly damaging 0.82
IGL03229:Nek10 APN 14 14986686 missense probably benign 0.10
P0041:Nek10 UTSW 14 14861603 missense probably benign 0.01
R0007:Nek10 UTSW 14 14840574 missense probably benign 0.10
R0007:Nek10 UTSW 14 14840574 missense probably benign 0.10
R0142:Nek10 UTSW 14 14861560 missense possibly damaging 0.96
R0433:Nek10 UTSW 14 14860927 missense probably benign 0.32
R0633:Nek10 UTSW 14 14857782 critical splice acceptor site probably null
R1087:Nek10 UTSW 14 14827059 missense possibly damaging 0.59
R1184:Nek10 UTSW 14 14931325 splice site probably benign
R1250:Nek10 UTSW 14 14853887 missense probably damaging 1.00
R1371:Nek10 UTSW 14 14850983 missense probably damaging 0.98
R1506:Nek10 UTSW 14 14999078 splice site probably benign
R1829:Nek10 UTSW 14 14863454 critical splice acceptor site probably null
R1831:Nek10 UTSW 14 14842789 missense probably benign
R1833:Nek10 UTSW 14 14842789 missense probably benign
R1990:Nek10 UTSW 14 14860764 missense probably benign
R1997:Nek10 UTSW 14 14827003 missense probably benign 0.09
R2011:Nek10 UTSW 14 14885122 missense probably damaging 1.00
R2158:Nek10 UTSW 14 14885047 splice site probably null
R2288:Nek10 UTSW 14 14853956 nonsense probably null
R2568:Nek10 UTSW 14 14999112 missense possibly damaging 0.89
R2907:Nek10 UTSW 14 14980613 missense possibly damaging 0.81
R2965:Nek10 UTSW 14 14836202 missense probably damaging 1.00
R4032:Nek10 UTSW 14 14853877 splice site probably null
R4700:Nek10 UTSW 14 14842841 missense possibly damaging 0.69
R4742:Nek10 UTSW 14 14861624 missense probably null 0.03
R4785:Nek10 UTSW 14 14855714 missense probably benign
R4890:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4891:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4920:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4924:Nek10 UTSW 14 14846594 splice site probably null
R4928:Nek10 UTSW 14 14930577 missense probably damaging 1.00
R4948:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4952:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4953:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R5092:Nek10 UTSW 14 14820851 missense possibly damaging 0.81
R5097:Nek10 UTSW 14 14857851 missense probably benign 0.00
R5593:Nek10 UTSW 14 14980544 nonsense probably null
R5696:Nek10 UTSW 14 14860736 splice site probably null
R5813:Nek10 UTSW 14 14986704 missense probably benign 0.01
R5829:Nek10 UTSW 14 14865404 missense probably damaging 1.00
R5872:Nek10 UTSW 14 14850896 missense probably benign 0.06
R5939:Nek10 UTSW 14 14931290 missense possibly damaging 0.58
R6025:Nek10 UTSW 14 14865633 missense probably benign 0.41
R6235:Nek10 UTSW 14 14821113 nonsense probably null
R6539:Nek10 UTSW 14 14860789 missense possibly damaging 0.94
R6542:Nek10 UTSW 14 14999108 missense probably benign 0.44
R6561:Nek10 UTSW 14 14828448 missense possibly damaging 0.48
R6659:Nek10 UTSW 14 14861684 missense probably benign 0.29
R7039:Nek10 UTSW 14 14826946 missense possibly damaging 0.63
R7039:Nek10 UTSW 14 14986700 missense probably damaging 0.99
R7102:Nek10 UTSW 14 14828517 missense probably damaging 1.00
R7185:Nek10 UTSW 14 14846621 missense probably benign 0.03
R7198:Nek10 UTSW 14 14850947 missense probably damaging 0.99
R7202:Nek10 UTSW 14 14836171 missense probably benign 0.01
R7251:Nek10 UTSW 14 14853965 missense probably benign
R7345:Nek10 UTSW 14 14955503 missense probably benign
R7590:Nek10 UTSW 14 15006693 makesense probably null
R7593:Nek10 UTSW 14 14826955 missense probably benign 0.04
R7616:Nek10 UTSW 14 14937759 missense probably benign 0.27
R7635:Nek10 UTSW 14 14850932 missense probably benign 0.01
R7817:Nek10 UTSW 14 15001017 missense probably benign 0.00
R7826:Nek10 UTSW 14 14860846 splice site probably null
R7986:Nek10 UTSW 14 15001020 missense probably benign 0.17
Z1177:Nek10 UTSW 14 14853948 missense probably benign 0.00
Z1177:Nek10 UTSW 14 15001157 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCAGCTTAGTGTAAATGCAGC -3'
(R):5'- ACTGCACCAATGTCCAGTATTTC -3'

Sequencing Primer
(F):5'- GTGTAAATGCAGCTAGACTCTCATGC -3'
(R):5'- CCGAACTGATTTATAAACGGCATGG -3'
Posted On2015-04-17