Incidental Mutation 'R3922:Msrb1'
ID306999
Institutional Source Beutler Lab
Gene Symbol Msrb1
Ensembl Gene ENSMUSG00000075705
Gene Namemethionine sulfoxide reductase B1
SynonymsSepr, SelR, Sepx1, D17Wsu82e
MMRRC Submission 040819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R3922 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24736642-24742778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24740083 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 70 (S70P)
Ref Sequence ENSEMBL: ENSMUSP00000110917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045186] [ENSMUST00000101800] [ENSMUST00000115262] [ENSMUST00000170239]
Predicted Effect probably benign
Transcript: ENSMUST00000045186
SMART Domains Protein: ENSMUSP00000038326
Gene: ENSMUSG00000002500

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 181 5.1e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101800
AA Change: S70P

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099300
Gene: ENSMUSG00000075705
AA Change: S70P

DomainStartEndE-ValueType
Pfam:SelR 5 105 9.7e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115262
AA Change: S70P

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110917
Gene: ENSMUSG00000075705
AA Change: S70P

DomainStartEndE-ValueType
Pfam:SelR 7 106 6.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170239
SMART Domains Protein: ENSMUSP00000129325
Gene: ENSMUSG00000002500

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 375 1.2e-178 PFAM
Meta Mutation Damage Score 0.1277 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the methionine-R-sulfoxide reductase B (MsrB) family. Members of this family function as repair enzymes that protect proteins from oxidative stress by catalyzing the reduction of methionine-R-sulfoxides to methionines. This protein is highly expressed in liver and kidney, and is localized to the nucleus and cytosol. It is the only member of the MsrB family that is a selenoprotein, containing a selenocysteine (Sec) residue at its active site. It also has the highest methionine-R-sulfoxide reductase activity compared to other members containing cysteine in place of Sec. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4921504E06Rik T A 2: 19,480,560 E432V probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Arhgef28 A G 13: 97,993,944 L462P possibly damaging Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cep70 T A 9: 99,275,579 *117R probably null Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Cntrl A G 2: 35,129,739 E526G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Eea1 T A 10: 96,036,633 N1068K probably benign Het
Egfr T A 11: 16,881,495 C555S probably damaging Het
Esd A T 14: 74,743,227 Q130H probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Gpr89 A T 3: 96,890,899 I147N probably damaging Het
H2-M10.1 T A 17: 36,325,685 I76L probably benign Het
Lgi4 A T 7: 31,067,448 D300V probably benign Het
Lrp1b C A 2: 40,677,581 V276L unknown Het
Lrp2 T C 2: 69,506,376 K1351E probably benign Het
Mroh8 T C 2: 157,222,811 I782V probably benign Het
Nek10 T C 14: 14,861,585 M547T possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Olfr615 T C 7: 103,560,705 V76A probably benign Het
Olfr769 C A 10: 129,111,613 V271F possibly damaging Het
P4htm T C 9: 108,582,895 N227D probably benign Het
Plekhm2 T C 4: 141,629,532 T787A probably benign Het
Pramel5 A G 4: 144,273,052 L155P probably damaging Het
Sbno1 T C 5: 124,381,930 Y1122C probably damaging Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Sft2d1 G T 17: 8,318,882 L34F possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc27a3 G T 3: 90,387,085 H460N possibly damaging Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Ssh1 T G 5: 113,942,708 Q865P possibly damaging Het
Trp63 A G 16: 25,889,009 D583G probably damaging Het
Usp28 T C 9: 49,030,923 probably null Het
Wdr43 A G 17: 71,638,301 probably benign Het
Zfhx4 A G 3: 5,400,647 Y1955C probably damaging Het
Zfp108 G A 7: 24,261,348 G455R probably damaging Het
Zfp353-ps A T 8: 42,083,012 noncoding transcript Het
Other mutations in Msrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4776:Msrb1 UTSW 17 24740173 missense probably damaging 1.00
R5466:Msrb1 UTSW 17 24739559 missense possibly damaging 0.82
R6865:Msrb1 UTSW 17 24736711 missense possibly damaging 0.88
R7196:Msrb1 UTSW 17 24739582 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GCACCCCAAGAATTTGTTGTTG -3'
(R):5'- CATGGCCGACAGATAAGCATAC -3'

Sequencing Primer
(F):5'- GACTATCCTGGAACTCACTTTGTAGG -3'
(R):5'- ATACACAGCCTGCCTCCCTG -3'
Posted On2015-04-17