Incidental Mutation 'R3922:Cnnm1'
ID307004
Institutional Source Beutler Lab
Gene Symbol Cnnm1
Ensembl Gene ENSMUSG00000025189
Gene Namecyclin M1
SynonymsAcdp1
MMRRC Submission 040819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R3922 (G1)
Quality Score116
Status Validated
Chromosome19
Chromosomal Location43440436-43497210 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 43440445 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000153472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165311] [ENSMUST00000223787]
Predicted Effect probably null
Transcript: ENSMUST00000165311
AA Change: M1V
SMART Domains Protein: ENSMUSP00000131830
Gene: ENSMUSG00000025189
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 25 32 N/A INTRINSIC
low complexity region 78 95 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 165 183 N/A INTRINSIC
low complexity region 193 202 N/A INTRINSIC
Pfam:DUF21 224 414 1.8e-27 PFAM
Blast:CBS 438 489 2e-12 BLAST
CBS 505 561 5.02e0 SMART
Blast:cNMP 634 802 2e-44 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000223787
AA Change: M1V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225283
Meta Mutation Damage Score 0.8405 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ancient conserved domain protein family. The encoded protein may bind copper. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4921504E06Rik T A 2: 19,480,560 E432V probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Arhgef28 A G 13: 97,993,944 L462P possibly damaging Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cep70 T A 9: 99,275,579 *117R probably null Het
Cntrl A G 2: 35,129,739 E526G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Eea1 T A 10: 96,036,633 N1068K probably benign Het
Egfr T A 11: 16,881,495 C555S probably damaging Het
Esd A T 14: 74,743,227 Q130H probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Gpr89 A T 3: 96,890,899 I147N probably damaging Het
H2-M10.1 T A 17: 36,325,685 I76L probably benign Het
Lgi4 A T 7: 31,067,448 D300V probably benign Het
Lrp1b C A 2: 40,677,581 V276L unknown Het
Lrp2 T C 2: 69,506,376 K1351E probably benign Het
Mroh8 T C 2: 157,222,811 I782V probably benign Het
Msrb1 T C 17: 24,740,083 S70P probably damaging Het
Nek10 T C 14: 14,861,585 M547T possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Olfr615 T C 7: 103,560,705 V76A probably benign Het
Olfr769 C A 10: 129,111,613 V271F possibly damaging Het
P4htm T C 9: 108,582,895 N227D probably benign Het
Plekhm2 T C 4: 141,629,532 T787A probably benign Het
Pramel5 A G 4: 144,273,052 L155P probably damaging Het
Sbno1 T C 5: 124,381,930 Y1122C probably damaging Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Sft2d1 G T 17: 8,318,882 L34F possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc27a3 G T 3: 90,387,085 H460N possibly damaging Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Ssh1 T G 5: 113,942,708 Q865P possibly damaging Het
Trp63 A G 16: 25,889,009 D583G probably damaging Het
Usp28 T C 9: 49,030,923 probably null Het
Wdr43 A G 17: 71,638,301 probably benign Het
Zfhx4 A G 3: 5,400,647 Y1955C probably damaging Het
Zfp108 G A 7: 24,261,348 G455R probably damaging Het
Zfp353-ps A T 8: 42,083,012 noncoding transcript Het
Other mutations in Cnnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Cnnm1 APN 19 43471936 missense probably benign 0.10
IGL02370:Cnnm1 APN 19 43471950 critical splice donor site probably null
R0329:Cnnm1 UTSW 19 43441910 missense probably damaging 1.00
R0400:Cnnm1 UTSW 19 43468364 missense probably damaging 1.00
R1417:Cnnm1 UTSW 19 43469723 missense probably benign 0.05
R1478:Cnnm1 UTSW 19 43471856 missense probably damaging 1.00
R1743:Cnnm1 UTSW 19 43471913 missense possibly damaging 0.93
R2290:Cnnm1 UTSW 19 43491502 missense probably benign
R2509:Cnnm1 UTSW 19 43441886 missense probably damaging 1.00
R2910:Cnnm1 UTSW 19 43469647 missense possibly damaging 0.58
R3107:Cnnm1 UTSW 19 43441561 missense probably damaging 0.97
R3109:Cnnm1 UTSW 19 43441561 missense probably damaging 0.97
R3923:Cnnm1 UTSW 19 43440445 start codon destroyed probably null
R4804:Cnnm1 UTSW 19 43491575 missense probably benign 0.02
R5199:Cnnm1 UTSW 19 43494986 missense possibly damaging 0.84
R5347:Cnnm1 UTSW 19 43441862 missense probably benign 0.42
R5595:Cnnm1 UTSW 19 43465157 missense possibly damaging 0.85
R5964:Cnnm1 UTSW 19 43469723 missense probably benign 0.42
R5969:Cnnm1 UTSW 19 43491472 missense probably damaging 1.00
R6383:Cnnm1 UTSW 19 43465266 critical splice donor site probably null
R7072:Cnnm1 UTSW 19 43440857 missense probably benign
R7092:Cnnm1 UTSW 19 43441948 missense probably damaging 1.00
R7126:Cnnm1 UTSW 19 43484853 missense probably damaging 1.00
R7432:Cnnm1 UTSW 19 43468271 missense probably benign 0.09
R7445:Cnnm1 UTSW 19 43440821 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTGTATCCAGGCTAGGCACTG -3'
(R):5'- AGGAGGAAGCTGGTGCCTTC -3'

Sequencing Primer
(F):5'- AGGCTAGGCACTGTGACG -3'
(R):5'- GTCGCAGACCCAGTAAC -3'
Posted On2015-04-17