Incidental Mutation 'R3923:Usp53'
ID307022
Institutional Source Beutler Lab
Gene Symbol Usp53
Ensembl Gene ENSMUSG00000039701
Gene Nameubiquitin specific peptidase 53
SynonymsPhxr3, Sp6
MMRRC Submission 040820-MU
Accession Numbers

Ncbi RefSeq: NM_133857.3; MGI: 2139607

Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R3923 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location122931493-122984510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122934305 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 876 (F876Y)
Ref Sequence ENSEMBL: ENSMUSP00000087857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090379]
Predicted Effect probably benign
Transcript: ENSMUST00000090379
AA Change: F876Y

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000087857
Gene: ENSMUSG00000039701
AA Change: F876Y

DomainStartEndE-ValueType
Pfam:UCH 29 348 1.6e-20 PFAM
Pfam:UCH_1 30 322 9.6e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for an ENU-induced allele show progressive hearing loss associated with altered cochlear outer hair cell (OHC) morphology, reduced endocochlear potential, and early OHC loss followed by IHC and spiral ganglion degeneration. Heterozygotes are susceptible to noise-induced hearing loss. [provided by MGI curators]
Allele List at MGI

All alleles(48) : Gene trapped(48)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T C 5: 8,130,514 M528V possibly damaging Het
Ano3 T A 2: 110,770,959 Y318F probably damaging Het
Asic4 T A 1: 75,451,227 D132E probably damaging Het
Atp2b2 A G 6: 113,797,108 probably null Het
Cast T C 13: 74,728,413 E447G probably damaging Het
Ccdc110 T C 8: 45,942,389 I439T probably damaging Het
Ccdc129 T C 6: 55,968,060 S589P probably benign Het
Ccdc50 A T 16: 27,444,544 R264S probably damaging Het
Chd9 T A 8: 90,933,519 V369E probably benign Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Col4a1 T A 8: 11,201,665 probably benign Het
Crtac1 A G 19: 42,333,947 V118A probably damaging Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Ehmt1 A T 2: 24,884,335 probably null Het
Emc1 T A 4: 139,363,185 L412* probably null Het
Ep400 T C 5: 110,756,523 N70S possibly damaging Het
Ercc6l2 T C 13: 63,870,735 probably benign Het
Fam69c A T 18: 84,730,687 T137S probably damaging Het
Fry T C 5: 150,413,349 V1395A probably benign Het
Gm281 T A 14: 13,865,990 K300* probably null Het
Gps1 A G 11: 120,786,433 N186S possibly damaging Het
Hdgf T A 3: 87,914,228 D128E probably benign Het
Hipk3 A G 2: 104,470,762 S362P probably damaging Het
Hypk C A 2: 121,458,202 H116Q possibly damaging Het
Ifna9 T A 4: 88,592,271 T39S possibly damaging Het
Itgae A C 11: 73,116,143 D405A probably damaging Het
Kdm5a T C 6: 120,381,664 S223P probably benign Het
Kif21a C T 15: 90,937,294 S1432N possibly damaging Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Lrrn2 A G 1: 132,938,492 S432G probably benign Het
Mlana T A 19: 29,704,698 S50R probably damaging Het
Mycbp2 A T 14: 103,126,713 H4383Q probably damaging Het
Ncor1 A G 11: 62,325,616 S1469P probably damaging Het
Nol6 G T 4: 41,121,531 F270L probably benign Het
Nr2c2 T A 6: 92,160,401 M431K probably damaging Het
Nrap T C 19: 56,380,256 I243V probably damaging Het
Obscn T C 11: 59,060,928 I4297V possibly damaging Het
Olfr1056 T C 2: 86,355,861 I174V probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Palb2 A T 7: 122,117,360 probably null Het
Plod1 T C 4: 147,915,823 K260E possibly damaging Het
Rgsl1 T C 1: 153,804,130 probably null Het
Rpe65 T A 3: 159,604,400 F103L probably benign Het
Ryr3 C T 2: 112,841,873 A1438T possibly damaging Het
Slc17a3 G A 13: 23,858,054 V402M possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Snph C T 2: 151,593,511 C430Y probably damaging Het
Tarbp1 T C 8: 126,440,771 I1101V probably benign Het
Tatdn1 G A 15: 58,921,171 L120F possibly damaging Het
Trav3-3 A G 14: 53,666,371 K49E probably benign Het
Trpv5 T C 6: 41,653,249 T636A probably benign Het
Ube2l6 A G 2: 84,809,074 D127G possibly damaging Het
Usp33 T A 3: 152,374,791 probably null Het
Utrn A T 10: 12,739,479 I316K probably benign Het
Zfp106 G T 2: 120,534,856 Q357K probably damaging Het
Zfp143 T C 7: 110,074,191 V138A probably damaging Het
Zfp451 T C 1: 33,779,045 R118G probably null Het
Other mutations in Usp53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Usp53 APN 3 122957718 missense probably damaging 0.99
IGL01965:Usp53 APN 3 122961153 critical splice donor site probably null
IGL02115:Usp53 APN 3 122947390 missense probably benign 0.25
IGL02993:Usp53 APN 3 122933843 missense probably damaging 1.00
IGL03119:Usp53 APN 3 122961415 missense possibly damaging 0.80
IGL03206:Usp53 APN 3 122953183 missense probably benign
IGL03369:Usp53 APN 3 122933721 utr 3 prime probably benign
R0066:Usp53 UTSW 3 122953307 nonsense probably null
R0066:Usp53 UTSW 3 122953307 nonsense probably null
R0366:Usp53 UTSW 3 122949201 missense probably damaging 1.00
R1015:Usp53 UTSW 3 122933759 missense probably benign 0.02
R1388:Usp53 UTSW 3 122957628 missense probably damaging 0.96
R1592:Usp53 UTSW 3 122934050 nonsense probably null
R1635:Usp53 UTSW 3 122934223 missense probably benign 0.03
R1707:Usp53 UTSW 3 122947400 missense probably benign
R2177:Usp53 UTSW 3 122936057 missense probably damaging 0.99
R2848:Usp53 UTSW 3 122934491 missense probably benign 0.00
R2898:Usp53 UTSW 3 122957574 nonsense probably null
R3411:Usp53 UTSW 3 122949858 critical splice acceptor site probably null
R3618:Usp53 UTSW 3 122934412 missense probably benign 0.25
R3713:Usp53 UTSW 3 122949319 missense probably benign 0.08
R3715:Usp53 UTSW 3 122949319 missense probably benign 0.08
R4616:Usp53 UTSW 3 122959120 missense probably damaging 1.00
R4718:Usp53 UTSW 3 122933982 missense probably benign 0.22
R4730:Usp53 UTSW 3 122962933 missense probably null 0.82
R4860:Usp53 UTSW 3 122961363 missense possibly damaging 0.90
R4860:Usp53 UTSW 3 122961363 missense possibly damaging 0.90
R5073:Usp53 UTSW 3 122933946 missense probably benign 0.21
R5580:Usp53 UTSW 3 122934234 missense probably benign 0.00
R5894:Usp53 UTSW 3 122959085 missense probably damaging 0.96
R6176:Usp53 UTSW 3 122934003 nonsense probably null
R6191:Usp53 UTSW 3 122949741 missense probably damaging 0.96
R6634:Usp53 UTSW 3 122964286 missense probably benign 0.00
R7179:Usp53 UTSW 3 122949710 missense probably benign 0.01
R7211:Usp53 UTSW 3 122957650 missense probably damaging 0.98
X0025:Usp53 UTSW 3 122957583 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTAACCTTGGTGCACTGGC -3'
(R):5'- GAGCATGTTTACCAGACAAATGAAC -3'

Sequencing Primer
(F):5'- TAACCTTGGTGCACTGGCTGTAG -3'
(R):5'- ACCAGATAGGAGCAAATGTTCAG -3'
Posted On2015-04-17