Incidental Mutation 'R3923:Rpe65'
ID 307024
Institutional Source Beutler Lab
Gene Symbol Rpe65
Ensembl Gene ENSMUSG00000028174
Gene Name retinal pigment epithelium 65
Synonyms rd12, Mord1, A930029L06Rik
MMRRC Submission 040820-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.192) question?
Stock # R3923 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 159304812-159330958 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 159310037 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 103 (F103L)
Ref Sequence ENSEMBL: ENSMUSP00000143654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999] [ENSMUST00000197771]
AlphaFold Q91ZQ5
Predicted Effect probably benign
Transcript: ENSMUST00000029824
AA Change: F103L

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: F103L

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196999
AA Change: F103L

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: F103L

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197771
SMART Domains Protein: ENSMUSP00000143390
Gene: ENSMUSG00000028174

DomainStartEndE-ValueType
Pfam:RPE65 13 109 5.8e-19 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T C 5: 8,180,514 (GRCm39) M528V possibly damaging Het
Ano3 T A 2: 110,601,304 (GRCm39) Y318F probably damaging Het
Asic4 T A 1: 75,427,871 (GRCm39) D132E probably damaging Het
Atp2b2 A G 6: 113,774,069 (GRCm39) probably null Het
Cast T C 13: 74,876,532 (GRCm39) E447G probably damaging Het
Ccdc110 T C 8: 46,395,426 (GRCm39) I439T probably damaging Het
Ccdc50 A T 16: 27,263,294 (GRCm39) R264S probably damaging Het
Cdhr18 T A 14: 13,865,990 (GRCm38) K300* probably null Het
Chd9 T A 8: 91,660,147 (GRCm39) V369E probably benign Het
Cnnm1 A G 19: 43,428,884 (GRCm39) M1V probably null Het
Col4a1 T A 8: 11,251,665 (GRCm39) probably benign Het
Crtac1 A G 19: 42,322,386 (GRCm39) V118A probably damaging Het
Ddx59 T A 1: 136,344,482 (GRCm39) V51D probably benign Het
Dipk1c A T 18: 84,748,812 (GRCm39) T137S probably damaging Het
Dtd2 G C 12: 52,051,734 (GRCm39) probably null Het
Ehmt1 A T 2: 24,774,347 (GRCm39) probably null Het
Emc1 T A 4: 139,090,496 (GRCm39) L412* probably null Het
Ep400 T C 5: 110,904,389 (GRCm39) N70S possibly damaging Het
Ercc6l2 T C 13: 64,018,549 (GRCm39) probably benign Het
Fry T C 5: 150,336,814 (GRCm39) V1395A probably benign Het
Gps1 A G 11: 120,677,259 (GRCm39) N186S possibly damaging Het
Hdgf T A 3: 87,821,535 (GRCm39) D128E probably benign Het
Hipk3 A G 2: 104,301,107 (GRCm39) S362P probably damaging Het
Hypk C A 2: 121,288,683 (GRCm39) H116Q possibly damaging Het
Ifna9 T A 4: 88,510,508 (GRCm39) T39S possibly damaging Het
Itgae A C 11: 73,006,969 (GRCm39) D405A probably damaging Het
Itprid1 T C 6: 55,945,045 (GRCm39) S589P probably benign Het
Kdm5a T C 6: 120,358,625 (GRCm39) S223P probably benign Het
Kif21a C T 15: 90,821,497 (GRCm39) S1432N possibly damaging Het
Klhl1 A T 14: 96,584,316 (GRCm39) C305S possibly damaging Het
Lrrn2 A G 1: 132,866,230 (GRCm39) S432G probably benign Het
Mlana T A 19: 29,682,098 (GRCm39) S50R probably damaging Het
Mycbp2 A T 14: 103,364,149 (GRCm39) H4383Q probably damaging Het
Ncor1 A G 11: 62,216,442 (GRCm39) S1469P probably damaging Het
Nol6 G T 4: 41,121,531 (GRCm39) F270L probably benign Het
Nr2c2 T A 6: 92,137,382 (GRCm39) M431K probably damaging Het
Nrap T C 19: 56,368,688 (GRCm39) I243V probably damaging Het
Obscn T C 11: 58,951,754 (GRCm39) I4297V possibly damaging Het
Onecut2 A G 18: 64,474,591 (GRCm39) K381E probably damaging Het
Or52n1 T A 7: 104,383,396 (GRCm39) E58D probably benign Het
Or8k23 T C 2: 86,186,205 (GRCm39) I174V probably benign Het
Palb2 A T 7: 121,716,583 (GRCm39) probably null Het
Plod1 T C 4: 148,000,280 (GRCm39) K260E possibly damaging Het
Rgsl1 T C 1: 153,679,876 (GRCm39) probably null Het
Ryr3 C T 2: 112,672,218 (GRCm39) A1438T possibly damaging Het
Slc17a3 G A 13: 24,042,037 (GRCm39) V402M possibly damaging Het
Slc19a3 A T 1: 83,000,678 (GRCm39) F113Y probably damaging Het
Snph C T 2: 151,435,431 (GRCm39) C430Y probably damaging Het
Tarbp1 T C 8: 127,167,510 (GRCm39) I1101V probably benign Het
Tatdn1 G A 15: 58,793,020 (GRCm39) L120F possibly damaging Het
Trav3-3 A G 14: 53,903,828 (GRCm39) K49E probably benign Het
Trpv5 T C 6: 41,630,183 (GRCm39) T636A probably benign Het
Ube2l6 A G 2: 84,639,418 (GRCm39) D127G possibly damaging Het
Usp33 T A 3: 152,080,428 (GRCm39) probably null Het
Usp53 A T 3: 122,727,954 (GRCm39) F876Y probably benign Het
Utrn A T 10: 12,615,223 (GRCm39) I316K probably benign Het
Zfp106 G T 2: 120,365,337 (GRCm39) Q357K probably damaging Het
Zfp143 T C 7: 109,673,398 (GRCm39) V138A probably damaging Het
Zfp451 T C 1: 33,818,126 (GRCm39) R118G probably null Het
Other mutations in Rpe65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rpe65 APN 3 159,320,179 (GRCm39) missense probably damaging 0.99
IGL01446:Rpe65 APN 3 159,306,042 (GRCm39) splice site probably benign
IGL01815:Rpe65 APN 3 159,310,167 (GRCm39) splice site probably null
IGL02085:Rpe65 APN 3 159,321,283 (GRCm39) missense probably benign 0.00
IGL02232:Rpe65 APN 3 159,309,988 (GRCm39) missense possibly damaging 0.93
IGL02248:Rpe65 APN 3 159,330,342 (GRCm39) missense probably damaging 1.00
IGL02645:Rpe65 APN 3 159,312,128 (GRCm39) missense probably damaging 0.99
IGL02711:Rpe65 APN 3 159,328,514 (GRCm39) missense possibly damaging 0.84
IGL02982:Rpe65 APN 3 159,305,998 (GRCm39) missense probably damaging 0.99
IGL03280:Rpe65 APN 3 159,309,978 (GRCm39) missense probably damaging 0.96
IGL03350:Rpe65 APN 3 159,320,154 (GRCm39) missense possibly damaging 0.75
IGL03356:Rpe65 APN 3 159,321,214 (GRCm39) missense possibly damaging 0.89
I1329:Rpe65 UTSW 3 159,330,360 (GRCm39) missense probably benign 0.35
R0571:Rpe65 UTSW 3 159,305,986 (GRCm39) missense probably damaging 1.00
R0905:Rpe65 UTSW 3 159,307,220 (GRCm39) missense possibly damaging 0.95
R1024:Rpe65 UTSW 3 159,312,122 (GRCm39) missense probably benign 0.07
R1597:Rpe65 UTSW 3 159,320,421 (GRCm39) missense probably damaging 0.97
R1657:Rpe65 UTSW 3 159,320,085 (GRCm39) missense probably damaging 0.97
R1778:Rpe65 UTSW 3 159,328,485 (GRCm39) missense probably damaging 1.00
R1970:Rpe65 UTSW 3 159,321,307 (GRCm39) missense probably benign
R2259:Rpe65 UTSW 3 159,321,208 (GRCm39) missense probably damaging 1.00
R3012:Rpe65 UTSW 3 159,310,200 (GRCm39) missense possibly damaging 0.61
R3975:Rpe65 UTSW 3 159,310,222 (GRCm39) missense probably damaging 1.00
R4204:Rpe65 UTSW 3 159,310,047 (GRCm39) missense probably damaging 0.99
R4825:Rpe65 UTSW 3 159,330,318 (GRCm39) missense probably benign
R4924:Rpe65 UTSW 3 159,328,268 (GRCm39) missense probably benign 0.01
R5269:Rpe65 UTSW 3 159,309,984 (GRCm39) missense probably benign 0.07
R5324:Rpe65 UTSW 3 159,310,041 (GRCm39) missense possibly damaging 0.94
R5441:Rpe65 UTSW 3 159,310,038 (GRCm39) missense probably damaging 1.00
R5854:Rpe65 UTSW 3 159,321,313 (GRCm39) missense probably benign
R5907:Rpe65 UTSW 3 159,321,319 (GRCm39) critical splice donor site probably null
R6149:Rpe65 UTSW 3 159,319,780 (GRCm39) missense probably benign
R6660:Rpe65 UTSW 3 159,320,345 (GRCm39) missense probably damaging 0.98
R6830:Rpe65 UTSW 3 159,319,805 (GRCm39) missense probably benign 0.06
R7025:Rpe65 UTSW 3 159,328,322 (GRCm39) missense probably damaging 1.00
R7092:Rpe65 UTSW 3 159,321,228 (GRCm39) missense probably damaging 1.00
R7203:Rpe65 UTSW 3 159,328,491 (GRCm39) missense probably damaging 0.99
R7366:Rpe65 UTSW 3 159,330,366 (GRCm39) missense probably benign 0.13
R7537:Rpe65 UTSW 3 159,310,246 (GRCm39) missense probably damaging 0.98
R7679:Rpe65 UTSW 3 159,310,030 (GRCm39) missense probably damaging 1.00
R8044:Rpe65 UTSW 3 159,320,342 (GRCm39) missense probably benign
R8179:Rpe65 UTSW 3 159,330,336 (GRCm39) missense probably benign 0.06
R8409:Rpe65 UTSW 3 159,319,785 (GRCm39) missense probably benign 0.01
R8558:Rpe65 UTSW 3 159,320,429 (GRCm39) missense probably damaging 1.00
R9042:Rpe65 UTSW 3 159,321,292 (GRCm39) missense probably damaging 1.00
R9483:Rpe65 UTSW 3 159,328,318 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTCTCTATCACCGGCTTGG -3'
(R):5'- AGTAATCTTCTCCCACTGGGTAG -3'

Sequencing Primer
(F):5'- ACCGGCTTGGGGAGATTC -3'
(R):5'- CTCCCACTGGGTAGATATTTACAAGG -3'
Posted On 2015-04-17