Mutagenetix > Incidental Mutations

Incidental Mutation 'R3923:Ep400'

307031

Institutional Source

Beutler Lab

Gene Symbol

Ep400

Ensembl Gene

ENSMUSG00000029505

Gene Name

E1A binding protein p400

Synonyms

mDomino, 1700020J09Rik, p400

MMRRC Submission

040820-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3923 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110664373-110770717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110756523 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 70 (N70S)

Ref Sequence

ENSEMBL: ENSMUSP00000138369 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112433] [ENSMUST00000112435] [ENSMUST00000112436] [ENSMUST00000146458]

Predicted Effect

unknown
Transcript: ENSMUST00000041558
AA Change: N70S

SMART Domains

Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: N70S

Domain	Start	End	E-Value	Type
Pfam:EP400_N	1	461	1.6e-232	PFAM
low complexity region	519	532	N/A	INTRINSIC
low complexity region	550	561	N/A	INTRINSIC
low complexity region	598	620	N/A	INTRINSIC
low complexity region	631	645	N/A	INTRINSIC
low complexity region	658	686	N/A	INTRINSIC
HSA	762	833	1.31e-31	SMART
low complexity region	908	925	N/A	INTRINSIC
DEXDc	1049	1238	2.76e-15	SMART
Blast:DEXDc	1276	1317	2e-15	BLAST
low complexity region	1407	1417	N/A	INTRINSIC
HELICc	1807	1893	1.17e-4	SMART
low complexity region	2006	2019	N/A	INTRINSIC
low complexity region	2080	2100	N/A	INTRINSIC
low complexity region	2214	2223	N/A	INTRINSIC
SANT	2243	2310	3.57e-1	SMART
low complexity region	2402	2489	N/A	INTRINSIC
low complexity region	2596	2608	N/A	INTRINSIC
low complexity region	2644	2679	N/A	INTRINSIC
low complexity region	2694	2738	N/A	INTRINSIC
low complexity region	2769	2806	N/A	INTRINSIC
low complexity region	2846	2883	N/A	INTRINSIC
low complexity region	2933	2947	N/A	INTRINSIC
low complexity region	2974	2986	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112433
AA Change: N70S

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000108052
Gene: ENSMUSG00000029505
AA Change: N70S

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
low complexity region	121	145	N/A	INTRINSIC
low complexity region	262	287	N/A	INTRINSIC
low complexity region	298	308	N/A	INTRINSIC
low complexity region	313	329	N/A	INTRINSIC
coiled coil region	418	447	N/A	INTRINSIC
low complexity region	471	485	N/A	INTRINSIC
low complexity region	556	569	N/A	INTRINSIC
low complexity region	587	598	N/A	INTRINSIC
low complexity region	635	657	N/A	INTRINSIC
low complexity region	666	677	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000112435
AA Change: N70S

SMART Domains

Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: N70S

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
low complexity region	121	145	N/A	INTRINSIC
low complexity region	262	287	N/A	INTRINSIC
low complexity region	298	308	N/A	INTRINSIC
low complexity region	313	329	N/A	INTRINSIC
coiled coil region	418	447	N/A	INTRINSIC
low complexity region	471	485	N/A	INTRINSIC
low complexity region	556	569	N/A	INTRINSIC
low complexity region	587	598	N/A	INTRINSIC
low complexity region	635	657	N/A	INTRINSIC
low complexity region	668	682	N/A	INTRINSIC
low complexity region	695	723	N/A	INTRINSIC
HSA	799	870	1.31e-31	SMART
low complexity region	945	962	N/A	INTRINSIC
DEXDc	1086	1275	2.76e-15	SMART
Blast:DEXDc	1313	1354	2e-15	BLAST
low complexity region	1444	1454	N/A	INTRINSIC
internal_repeat_1	1556	1646	6.82e-5	PROSPERO
low complexity region	1887	1900	N/A	INTRINSIC
low complexity region	1961	1981	N/A	INTRINSIC
low complexity region	2095	2104	N/A	INTRINSIC
SANT	2124	2191	3.57e-1	SMART
low complexity region	2283	2370	N/A	INTRINSIC
internal_repeat_1	2371	2463	6.82e-5	PROSPERO
low complexity region	2477	2489	N/A	INTRINSIC
low complexity region	2525	2560	N/A	INTRINSIC
low complexity region	2575	2619	N/A	INTRINSIC
low complexity region	2645	2659	N/A	INTRINSIC
low complexity region	2660	2680	N/A	INTRINSIC
low complexity region	2720	2757	N/A	INTRINSIC
low complexity region	2807	2821	N/A	INTRINSIC
low complexity region	2848	2860	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000112436
AA Change: N70S

SMART Domains

Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: N70S

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
low complexity region	121	145	N/A	INTRINSIC
low complexity region	262	287	N/A	INTRINSIC
low complexity region	298	308	N/A	INTRINSIC
low complexity region	313	329	N/A	INTRINSIC
coiled coil region	418	449	N/A	INTRINSIC
low complexity region	472	482	N/A	INTRINSIC
low complexity region	483	496	N/A	INTRINSIC
low complexity region	514	525	N/A	INTRINSIC
low complexity region	562	584	N/A	INTRINSIC
low complexity region	595	609	N/A	INTRINSIC
low complexity region	622	650	N/A	INTRINSIC
HSA	726	797	1.31e-31	SMART
low complexity region	872	889	N/A	INTRINSIC
DEXDc	1013	1202	2.76e-15	SMART
Blast:DEXDc	1240	1281	2e-15	BLAST
low complexity region	1371	1381	N/A	INTRINSIC
internal_repeat_1	1483	1573	6.76e-5	PROSPERO
HELICc	1771	1857	1.17e-4	SMART
low complexity region	1970	1983	N/A	INTRINSIC
low complexity region	2044	2064	N/A	INTRINSIC
low complexity region	2178	2187	N/A	INTRINSIC
SANT	2207	2274	3.57e-1	SMART
low complexity region	2366	2453	N/A	INTRINSIC
internal_repeat_1	2454	2546	6.76e-5	PROSPERO
low complexity region	2560	2572	N/A	INTRINSIC
low complexity region	2608	2643	N/A	INTRINSIC
low complexity region	2658	2702	N/A	INTRINSIC
low complexity region	2733	2770	N/A	INTRINSIC
low complexity region	2810	2847	N/A	INTRINSIC
low complexity region	2897	2911	N/A	INTRINSIC
low complexity region	2938	2950	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000146458
AA Change: N70S

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000138369
Gene: ENSMUSG00000029505
AA Change: N70S

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
low complexity region	121	145	N/A	INTRINSIC
low complexity region	262	287	N/A	INTRINSIC
low complexity region	298	308	N/A	INTRINSIC
low complexity region	313	329	N/A	INTRINSIC
coiled coil region	418	449	N/A	INTRINSIC
low complexity region	519	532	N/A	INTRINSIC
low complexity region	550	561	N/A	INTRINSIC
low complexity region	598	620	N/A	INTRINSIC
low complexity region	629	640	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146652

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000178031

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	T	C	5: 8,130,514	M528V	possibly damaging	Het
Ano3	T	A	2: 110,770,959	Y318F	probably damaging	Het
Asic4	T	A	1: 75,451,227	D132E	probably damaging	Het
Atp2b2	A	G	6: 113,797,108		probably null	Het
Cast	T	C	13: 74,728,413	E447G	probably damaging	Het
Ccdc110	T	C	8: 45,942,389	I439T	probably damaging	Het
Ccdc129	T	C	6: 55,968,060	S589P	probably benign	Het
Ccdc50	A	T	16: 27,444,544	R264S	probably damaging	Het
Chd9	T	A	8: 90,933,519	V369E	probably benign	Het
Cnnm1	A	G	19: 43,440,445	M1V	probably null	Het
Col4a1	T	A	8: 11,201,665		probably benign	Het
Crtac1	A	G	19: 42,333,947	V118A	probably damaging	Het
Ddx59	T	A	1: 136,416,744	V51D	probably benign	Het
Dtd2	G	C	12: 52,004,951		probably null	Het
Ehmt1	A	T	2: 24,884,335		probably null	Het
Emc1	T	A	4: 139,363,185	L412*	probably null	Het
Ercc6l2	T	C	13: 63,870,735		probably benign	Het
Fam69c	A	T	18: 84,730,687	T137S	probably damaging	Het
Fry	T	C	5: 150,413,349	V1395A	probably benign	Het
Gm281	T	A	14: 13,865,990	K300*	probably null	Het
Gps1	A	G	11: 120,786,433	N186S	possibly damaging	Het
Hdgf	T	A	3: 87,914,228	D128E	probably benign	Het
Hipk3	A	G	2: 104,470,762	S362P	probably damaging	Het
Hypk	C	A	2: 121,458,202	H116Q	possibly damaging	Het
Ifna9	T	A	4: 88,592,271	T39S	possibly damaging	Het
Itgae	A	C	11: 73,116,143	D405A	probably damaging	Het
Kdm5a	T	C	6: 120,381,664	S223P	probably benign	Het
Kif21a	C	T	15: 90,937,294	S1432N	possibly damaging	Het
Klhl1	A	T	14: 96,346,880	C305S	possibly damaging	Het
Lrrn2	A	G	1: 132,938,492	S432G	probably benign	Het
Mlana	T	A	19: 29,704,698	S50R	probably damaging	Het
Mycbp2	A	T	14: 103,126,713	H4383Q	probably damaging	Het
Ncor1	A	G	11: 62,325,616	S1469P	probably damaging	Het
Nol6	G	T	4: 41,121,531	F270L	probably benign	Het
Nr2c2	T	A	6: 92,160,401	M431K	probably damaging	Het
Nrap	T	C	19: 56,380,256	I243V	probably damaging	Het
Obscn	T	C	11: 59,060,928	I4297V	possibly damaging	Het
Olfr1056	T	C	2: 86,355,861	I174V	probably benign	Het
Olfr664	T	A	7: 104,734,189	E58D	probably benign	Het
Onecut2	A	G	18: 64,341,520	K381E	probably damaging	Het
Palb2	A	T	7: 122,117,360		probably null	Het
Plod1	T	C	4: 147,915,823	K260E	possibly damaging	Het
Rgsl1	T	C	1: 153,804,130		probably null	Het
Rpe65	T	A	3: 159,604,400	F103L	probably benign	Het
Ryr3	C	T	2: 112,841,873	A1438T	possibly damaging	Het
Slc17a3	G	A	13: 23,858,054	V402M	possibly damaging	Het
Slc19a3	A	T	1: 83,022,957	F113Y	probably damaging	Het
Snph	C	T	2: 151,593,511	C430Y	probably damaging	Het
Tarbp1	T	C	8: 126,440,771	I1101V	probably benign	Het
Tatdn1	G	A	15: 58,921,171	L120F	possibly damaging	Het
Trav3-3	A	G	14: 53,666,371	K49E	probably benign	Het
Trpv5	T	C	6: 41,653,249	T636A	probably benign	Het
Ube2l6	A	G	2: 84,809,074	D127G	possibly damaging	Het
Usp33	T	A	3: 152,374,791		probably null	Het
Usp53	A	T	3: 122,934,305	F876Y	probably benign	Het
Utrn	A	T	10: 12,739,479	I316K	probably benign	Het
Zfp106	G	T	2: 120,534,856	Q357K	probably damaging	Het
Zfp143	T	C	7: 110,074,191	V138A	probably damaging	Het
Zfp451	T	C	1: 33,779,045	R118G	probably null	Het

Other mutations in Ep400

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Ep400	APN	5	110687841	missense	unknown
IGL00585:Ep400	APN	5	110755905	missense	possibly damaging	0.70
IGL00586:Ep400	APN	5	110739594	missense	probably damaging	1.00
IGL00816:Ep400	APN	5	110735490	unclassified	probably benign
IGL01066:Ep400	APN	5	110668199	splice site	probably benign
IGL01302:Ep400	APN	5	110742048	missense	probably benign	0.00
IGL01568:Ep400	APN	5	110719495	missense	unknown
IGL01833:Ep400	APN	5	110680008	missense	unknown
IGL02086:Ep400	APN	5	110676943	splice site	probably benign
IGL02266:Ep400	APN	5	110695297	unclassified	probably benign
IGL02288:Ep400	APN	5	110683836	splice site	probably benign
IGL02301:Ep400	APN	5	110674960	missense	probably damaging	1.00
IGL02377:Ep400	APN	5	110720825	missense	unknown
IGL02382:Ep400	APN	5	110701728	missense	unknown
IGL02419:Ep400	APN	5	110697376	splice site	probably null
IGL02591:Ep400	APN	5	110733772	unclassified	probably benign
IGL02981:Ep400	APN	5	110756103	missense	possibly damaging	0.79
IGL02981:Ep400	APN	5	110691610	splice site	probably benign
IGL03173:Ep400	APN	5	110708871	unclassified	probably benign
IGL03244:Ep400	APN	5	110727563	missense	unknown
IGL03333:Ep400	APN	5	110703566	missense	unknown
santol	UTSW	5	110701671	missense	unknown
PIT4243001:Ep400	UTSW	5	110735580	missense	unknown
PIT4260001:Ep400	UTSW	5	110693171	nonsense	probably null
R0017:Ep400	UTSW	5	110673529	missense	probably damaging	1.00
R0179:Ep400	UTSW	5	110668649	missense	probably damaging	0.99
R0243:Ep400	UTSW	5	110724407	splice site	probably benign
R0366:Ep400	UTSW	5	110701671	missense	unknown
R0508:Ep400	UTSW	5	110739508	missense	probably benign	0.00
R0541:Ep400	UTSW	5	110705016	missense	unknown
R0558:Ep400	UTSW	5	110685067	splice site	probably benign
R0576:Ep400	UTSW	5	110711093	unclassified	probably benign
R0595:Ep400	UTSW	5	110703542	missense	unknown
R0671:Ep400	UTSW	5	110688196	missense	unknown
R0763:Ep400	UTSW	5	110665837	missense	probably damaging	1.00
R1078:Ep400	UTSW	5	110735522	unclassified	probably benign
R1300:Ep400	UTSW	5	110673560	missense	probably damaging	1.00
R1439:Ep400	UTSW	5	110685478	missense	unknown
R1520:Ep400	UTSW	5	110691778	intron	probably benign
R1529:Ep400	UTSW	5	110739445	missense	probably benign	0.00
R1535:Ep400	UTSW	5	110708166	unclassified	probably benign
R1560:Ep400	UTSW	5	110671106	splice site	probably null
R1587:Ep400	UTSW	5	110726902	missense	probably benign	0.23
R1596:Ep400	UTSW	5	110708861	unclassified	probably benign
R1653:Ep400	UTSW	5	110693174	nonsense	probably null
R1711:Ep400	UTSW	5	110693308	unclassified	probably benign
R1774:Ep400	UTSW	5	110685491	missense	unknown
R1836:Ep400	UTSW	5	110705054	missense	unknown
R1905:Ep400	UTSW	5	110670948	missense	probably damaging	1.00
R1917:Ep400	UTSW	5	110703575	missense	unknown
R2064:Ep400	UTSW	5	110735404	unclassified	probably benign
R2122:Ep400	UTSW	5	110708850	unclassified	probably benign
R2144:Ep400	UTSW	5	110703518	missense	unknown
R2215:Ep400	UTSW	5	110693555	unclassified	probably benign
R2252:Ep400	UTSW	5	110719091	missense	unknown
R2253:Ep400	UTSW	5	110719091	missense	unknown
R2483:Ep400	UTSW	5	110719236	missense	unknown
R2504:Ep400	UTSW	5	110668645	missense	probably damaging	1.00
R2512:Ep400	UTSW	5	110708915	unclassified	probably benign
R2842:Ep400	UTSW	5	110698815	nonsense	probably null
R2920:Ep400	UTSW	5	110755914	missense	probably damaging	1.00
R3082:Ep400	UTSW	5	110693230	unclassified	probably benign
R3151:Ep400	UTSW	5	110703569	missense	unknown
R3552:Ep400	UTSW	5	110729287	missense	unknown
R3623:Ep400	UTSW	5	110719236	missense	unknown
R3779:Ep400	UTSW	5	110691649	missense	unknown
R4062:Ep400	UTSW	5	110741981	missense	probably benign	0.10
R4508:Ep400	UTSW	5	110703615	missense	unknown
R4584:Ep400	UTSW	5	110733897	unclassified	probably benign
R4585:Ep400	UTSW	5	110753859	missense	probably damaging	1.00
R4586:Ep400	UTSW	5	110753859	missense	probably damaging	1.00
R4807:Ep400	UTSW	5	110695578	splice site	probably null
R4921:Ep400	UTSW	5	110665810	missense	probably damaging	1.00
R4976:Ep400	UTSW	5	110698812	missense	unknown
R4976:Ep400	UTSW	5	110720756	missense	unknown
R5075:Ep400	UTSW	5	110685485	missense	unknown
R5120:Ep400	UTSW	5	110756358	missense	probably damaging	1.00
R5122:Ep400	UTSW	5	110668170	missense	probably damaging	1.00
R5223:Ep400	UTSW	5	110668630	missense	probably damaging	1.00
R5284:Ep400	UTSW	5	110668124	missense	probably damaging	1.00
R5388:Ep400	UTSW	5	110701728	missense	unknown
R5401:Ep400	UTSW	5	110683171	missense	unknown
R5431:Ep400	UTSW	5	110676554	missense	unknown
R5461:Ep400	UTSW	5	110676684	nonsense	probably null
R5568:Ep400	UTSW	5	110756205	missense	probably damaging	1.00
R5650:Ep400	UTSW	5	110695952	critical splice donor site	probably null
R5778:Ep400	UTSW	5	110719584	missense	unknown
R5806:Ep400	UTSW	5	110755554	nonsense	probably null
R5814:Ep400	UTSW	5	110695578	splice site	probably null
R5830:Ep400	UTSW	5	110683996	missense	unknown
R5882:Ep400	UTSW	5	110755587	missense	probably benign	0.00
R5931:Ep400	UTSW	5	110735520	unclassified	probably benign
R5945:Ep400	UTSW	5	110682866	missense	unknown
R5966:Ep400	UTSW	5	110676900	missense	unknown
R5973:Ep400	UTSW	5	110729831	missense	unknown
R5980:Ep400	UTSW	5	110733729	unclassified	probably benign
R6000:Ep400	UTSW	5	110683201	missense	unknown
R6006:Ep400	UTSW	5	110704959	missense	unknown
R6053:Ep400	UTSW	5	110755795	missense	probably benign	0.22
R6145:Ep400	UTSW	5	110756703	missense	possibly damaging	0.95
R6154:Ep400	UTSW	5	110755933	missense	probably damaging	0.97
R6169:Ep400	UTSW	5	110741997	missense	possibly damaging	0.83
R6228:Ep400	UTSW	5	110670942	missense	probably damaging	1.00
R6295:Ep400	UTSW	5	110753809	missense	probably benign	0.00
R6486:Ep400	UTSW	5	110697218	unclassified	probably benign
R6504:Ep400	UTSW	5	110708837	unclassified	probably benign
R6607:Ep400	UTSW	5	110683314	missense	unknown
R6657:Ep400	UTSW	5	110693545	unclassified	probably benign
R6660:Ep400	UTSW	5	110719447	nonsense	probably null
R6741:Ep400	UTSW	5	110676895	missense	unknown
R6933:Ep400	UTSW	5	110665862	missense	probably damaging	1.00
R6937:Ep400	UTSW	5	110711152	unclassified	probably benign
R7069:Ep400	UTSW	5	110668124	missense	probably damaging	1.00
R7103:Ep400	UTSW	5	110733785	missense	unknown
R7156:Ep400	UTSW	5	110685363	missense	unknown
R7272:Ep400	UTSW	5	110755645	nonsense	probably null
R7365:Ep400	UTSW	5	110719614	missense	unknown
R7581:Ep400	UTSW	5	110756025	missense	unknown
R7684:Ep400	UTSW	5	110697352	missense	unknown
R7699:Ep400	UTSW	5	110696032	missense	unknown
R7700:Ep400	UTSW	5	110696032	missense	unknown
R7856:Ep400	UTSW	5	110666584	missense	probably damaging	0.99
R7954:Ep400	UTSW	5	110668733	missense	possibly damaging	0.46
R8098:Ep400	UTSW	5	110693251	missense	unknown
R8108:Ep400	UTSW	5	110687883	missense	unknown
R8260:Ep400	UTSW	5	110755612	nonsense	probably null
R8293:Ep400	UTSW	5	110708892	missense	unknown
R8314:Ep400	UTSW	5	110755753	missense	unknown
R8424:Ep400	UTSW	5	110693278	missense	unknown
R8459:Ep400	UTSW	5	110708891	missense	unknown
X0012:Ep400	UTSW	5	110673196	small deletion	probably benign
X0021:Ep400	UTSW	5	110682864	missense	unknown
Z1176:Ep400	UTSW	5	110756635	missense	unknown
Z1177:Ep400	UTSW	5	110683364	missense	unknown
Z1177:Ep400	UTSW	5	110733743	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CTTTGAGTCTGGACCTGCTG -3'
(R):5'- GATAATGCACCATGGCAGTGG -3'

Sequencing Primer
(F):5'- TCTGGACCTGCTGCGACATC -3'
(R):5'- GTGGTCCTCAGAATGTCCAAC -3'

Posted On

2015-04-17