Incidental Mutation 'R3923:Kdm5a'
ID307038
Institutional Source Beutler Lab
Gene Symbol Kdm5a
Ensembl Gene ENSMUSG00000030180
Gene Namelysine (K)-specific demethylase 5A
SynonymsJarid1a, Rbbp2, RBP2
MMRRC Submission 040820-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3923 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location120364124-120444574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120381664 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 223 (S223P)
Ref Sequence ENSEMBL: ENSMUSP00000005108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005108] [ENSMUST00000132009] [ENSMUST00000135802] [ENSMUST00000203373]
Predicted Effect probably benign
Transcript: ENSMUST00000005108
AA Change: S223P

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000005108
Gene: ENSMUSG00000030180
AA Change: S223P

DomainStartEndE-ValueType
JmjN 18 59 4.06e-20 SMART
ARID 81 170 4.76e-35 SMART
BRIGHT 85 175 2.48e-31 SMART
PHD 295 341 1.16e-14 SMART
Blast:JmjC 384 436 2e-22 BLAST
JmjC 437 603 5.88e-73 SMART
low complexity region 638 651 N/A INTRINSIC
Pfam:zf-C5HC2 676 729 1.3e-21 PFAM
Pfam:PLU-1 740 1072 1.2e-104 PFAM
low complexity region 1091 1119 N/A INTRINSIC
PHD 1163 1216 1.37e-11 SMART
low complexity region 1269 1280 N/A INTRINSIC
low complexity region 1337 1351 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1494 1512 N/A INTRINSIC
coiled coil region 1534 1579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100996
AA Change: S223P

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000098558
Gene: ENSMUSG00000030180
AA Change: S223P

DomainStartEndE-ValueType
JmjN 18 59 4.06e-20 SMART
ARID 81 170 4.76e-35 SMART
BRIGHT 85 175 2.48e-31 SMART
PHD 295 341 1.16e-14 SMART
Blast:JmjC 384 436 2e-22 BLAST
JmjC 437 603 5.88e-73 SMART
low complexity region 638 651 N/A INTRINSIC
Pfam:zf-C5HC2 676 728 3.6e-17 PFAM
Pfam:PLU-1 741 1072 5e-104 PFAM
low complexity region 1091 1119 N/A INTRINSIC
PHD 1163 1216 1.37e-11 SMART
low complexity region 1269 1280 N/A INTRINSIC
low complexity region 1337 1351 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1494 1512 N/A INTRINSIC
coiled coil region 1534 1579 N/A INTRINSIC
PHD 1614 1659 1.27e-6 SMART
low complexity region 1662 1674 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122505
Predicted Effect probably benign
Transcript: ENSMUST00000132009
AA Change: S223P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145375
Gene: ENSMUSG00000030180
AA Change: S223P

DomainStartEndE-ValueType
JmjN 18 59 4.06e-20 SMART
ARID 81 170 4.76e-35 SMART
BRIGHT 85 175 2.48e-31 SMART
PHD 295 341 1.16e-14 SMART
JmjC 437 603 1.47e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135802
AA Change: S223P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145021
Gene: ENSMUSG00000030180
AA Change: S223P

DomainStartEndE-ValueType
JmjN 18 59 1.7e-22 SMART
ARID 81 170 3.6e-39 SMART
BRIGHT 85 175 1.2e-33 SMART
PHD 295 341 7.3e-17 SMART
Blast:JmjC 384 436 2e-22 BLAST
JmjC 437 603 2.2e-75 SMART
low complexity region 638 651 N/A INTRINSIC
Pfam:zf-C5HC2 676 728 6.3e-15 PFAM
Pfam:PLU-1 741 811 9.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203373
SMART Domains Protein: ENSMUSP00000144720
Gene: ENSMUSG00000030180

DomainStartEndE-ValueType
BRIGHT 1 53 8.4e-4 SMART
Blast:JmjC 58 153 3e-56 BLAST
PDB:2E6R|A 121 152 4e-9 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Jumonji, AT-rich interactive domain 1 (JARID1) histone demethylase protein family. The encoded protein plays a role in gene regulation through the histone code by specifically demethylating lysine 4 of histone H3. The encoded protein interacts with many other proteins, including retinoblastoma protein, and is implicated in the transcriptional regulation of Hox genes and cytokines. This gene may play a role in tumor progression. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body size, abnormal involuntary movement and quantitative changes in the hematopoietic stem cell and myeloid progenitor compartments, consistent with enhanced survival and increased cycling. Neonatalsurvival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T C 5: 8,130,514 M528V possibly damaging Het
Ano3 T A 2: 110,770,959 Y318F probably damaging Het
Asic4 T A 1: 75,451,227 D132E probably damaging Het
Atp2b2 A G 6: 113,797,108 probably null Het
Cast T C 13: 74,728,413 E447G probably damaging Het
Ccdc110 T C 8: 45,942,389 I439T probably damaging Het
Ccdc129 T C 6: 55,968,060 S589P probably benign Het
Ccdc50 A T 16: 27,444,544 R264S probably damaging Het
Chd9 T A 8: 90,933,519 V369E probably benign Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Col4a1 T A 8: 11,201,665 probably benign Het
Crtac1 A G 19: 42,333,947 V118A probably damaging Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Ehmt1 A T 2: 24,884,335 probably null Het
Emc1 T A 4: 139,363,185 L412* probably null Het
Ep400 T C 5: 110,756,523 N70S possibly damaging Het
Ercc6l2 T C 13: 63,870,735 probably benign Het
Fam69c A T 18: 84,730,687 T137S probably damaging Het
Fry T C 5: 150,413,349 V1395A probably benign Het
Gm281 T A 14: 13,865,990 K300* probably null Het
Gps1 A G 11: 120,786,433 N186S possibly damaging Het
Hdgf T A 3: 87,914,228 D128E probably benign Het
Hipk3 A G 2: 104,470,762 S362P probably damaging Het
Hypk C A 2: 121,458,202 H116Q possibly damaging Het
Ifna9 T A 4: 88,592,271 T39S possibly damaging Het
Itgae A C 11: 73,116,143 D405A probably damaging Het
Kif21a C T 15: 90,937,294 S1432N possibly damaging Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Lrrn2 A G 1: 132,938,492 S432G probably benign Het
Mlana T A 19: 29,704,698 S50R probably damaging Het
Mycbp2 A T 14: 103,126,713 H4383Q probably damaging Het
Ncor1 A G 11: 62,325,616 S1469P probably damaging Het
Nol6 G T 4: 41,121,531 F270L probably benign Het
Nr2c2 T A 6: 92,160,401 M431K probably damaging Het
Nrap T C 19: 56,380,256 I243V probably damaging Het
Obscn T C 11: 59,060,928 I4297V possibly damaging Het
Olfr1056 T C 2: 86,355,861 I174V probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Palb2 A T 7: 122,117,360 probably null Het
Plod1 T C 4: 147,915,823 K260E possibly damaging Het
Rgsl1 T C 1: 153,804,130 probably null Het
Rpe65 T A 3: 159,604,400 F103L probably benign Het
Ryr3 C T 2: 112,841,873 A1438T possibly damaging Het
Slc17a3 G A 13: 23,858,054 V402M possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Snph C T 2: 151,593,511 C430Y probably damaging Het
Tarbp1 T C 8: 126,440,771 I1101V probably benign Het
Tatdn1 G A 15: 58,921,171 L120F possibly damaging Het
Trav3-3 A G 14: 53,666,371 K49E probably benign Het
Trpv5 T C 6: 41,653,249 T636A probably benign Het
Ube2l6 A G 2: 84,809,074 D127G possibly damaging Het
Usp33 T A 3: 152,374,791 probably null Het
Usp53 A T 3: 122,934,305 F876Y probably benign Het
Utrn A T 10: 12,739,479 I316K probably benign Het
Zfp106 G T 2: 120,534,856 Q357K probably damaging Het
Zfp143 T C 7: 110,074,191 V138A probably damaging Het
Zfp451 T C 1: 33,779,045 R118G probably null Het
Other mutations in Kdm5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Kdm5a APN 6 120385719 critical splice donor site probably null 0.00
IGL00706:Kdm5a APN 6 120406636 missense possibly damaging 0.44
IGL01361:Kdm5a APN 6 120399016 missense probably damaging 1.00
IGL01402:Kdm5a APN 6 120390679 nonsense probably null 0.00
IGL01924:Kdm5a APN 6 120394255 critical splice donor site probably null 0.00
IGL01935:Kdm5a APN 6 120408323 missense probably benign 0.02
IGL02165:Kdm5a APN 6 120415290 missense probably damaging 1.00
IGL02472:Kdm5a APN 6 120406730 splice site probably benign
IGL02506:Kdm5a APN 6 120432149 missense probably damaging 0.99
IGL02604:Kdm5a APN 6 120431980 missense probably benign
IGL02633:Kdm5a APN 6 120364719 missense probably damaging 1.00
IGL02876:Kdm5a APN 6 120390644 unclassified probably benign
IGL03009:Kdm5a APN 6 120430086 missense probably damaging 0.98
IGL03027:Kdm5a APN 6 120374990 splice site probably null
IGL03164:Kdm5a APN 6 120439019 missense probably damaging 1.00
IGL03236:Kdm5a APN 6 120438988 missense probably damaging 0.98
IGL03276:Kdm5a APN 6 120402708 splice site probably benign
Augmented UTSW 6 120430016 intron probably benign
calla_lily UTSW 6 120405022 missense probably damaging 1.00
crocus UTSW 6 120399038 missense probably null 0.98
Magnolia UTSW 6 120398978 missense probably damaging 0.99
Selbst UTSW 6 120388105 nonsense probably null
R0320:Kdm5a UTSW 6 120389620 missense probably benign 0.19
R0462:Kdm5a UTSW 6 120402600 missense probably damaging 1.00
R0601:Kdm5a UTSW 6 120402671 missense possibly damaging 0.76
R0628:Kdm5a UTSW 6 120415239 missense probably damaging 1.00
R1024:Kdm5a UTSW 6 120399038 missense probably null 0.98
R2013:Kdm5a UTSW 6 120431990 missense probably benign 0.09
R2015:Kdm5a UTSW 6 120431990 missense probably benign 0.09
R2061:Kdm5a UTSW 6 120381617 missense probably benign
R2188:Kdm5a UTSW 6 120406640 missense possibly damaging 0.59
R4013:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4016:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4017:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4030:Kdm5a UTSW 6 120405113 nonsense probably null
R4646:Kdm5a UTSW 6 120374977 missense possibly damaging 0.55
R4737:Kdm5a UTSW 6 120406015 intron probably benign
R4779:Kdm5a UTSW 6 120369099 unclassified probably benign
R4836:Kdm5a UTSW 6 120412402 missense probably damaging 1.00
R5129:Kdm5a UTSW 6 120405022 missense probably damaging 1.00
R5182:Kdm5a UTSW 6 120388105 nonsense probably null
R5183:Kdm5a UTSW 6 120430016 intron probably benign
R5572:Kdm5a UTSW 6 120412375 missense possibly damaging 0.69
R6110:Kdm5a UTSW 6 120412306 missense probably damaging 1.00
R6132:Kdm5a UTSW 6 120374931 missense probably damaging 1.00
R6198:Kdm5a UTSW 6 120438997 missense probably benign 0.37
R6246:Kdm5a UTSW 6 120431910 missense probably damaging 0.97
R6336:Kdm5a UTSW 6 120398978 missense probably damaging 0.99
R6343:Kdm5a UTSW 6 120382933 missense probably benign 0.01
R6612:Kdm5a UTSW 6 120430228 missense probably damaging 0.99
R6647:Kdm5a UTSW 6 120412461 missense probably benign 0.25
R7068:Kdm5a UTSW 6 120430215 missense probably benign 0.40
R7369:Kdm5a UTSW 6 120432004 missense possibly damaging 0.67
R7380:Kdm5a UTSW 6 120405918 missense probably benign 0.35
R7411:Kdm5a UTSW 6 120426815 missense probably damaging 1.00
R7521:Kdm5a UTSW 6 120432187 nonsense probably null
R7570:Kdm5a UTSW 6 120427842 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACTGTGAAGTCAGGATTACCACC -3'
(R):5'- CCCCAAATGATTAAGTTCATGAGATCC -3'

Sequencing Primer
(F):5'- AGGGACTTATCTGGAAACTTGC -3'
(R):5'- CTTTGATCAAGCATTCAGGAGGC -3'
Posted On2015-04-17