Incidental Mutation 'R3923:Col4a1'
ID307043
Institutional Source Beutler Lab
Gene Symbol Col4a1
Ensembl Gene ENSMUSG00000031502
Gene Namecollagen, type IV, alpha 1
SynonymsDel(8)Bru44H, Svc, Raw, Del(8)44H, Bru, Col4a-1, alpha1(IV) collagen
MMRRC Submission 040820-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3923 (G1)
Quality Score224
Status Not validated
Chromosome8
Chromosomal Location11198423-11312826 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to A at 11201665 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033898] [ENSMUST00000209735]
Predicted Effect unknown
Transcript: ENSMUST00000033898
AA Change: M1641L
SMART Domains Protein: ENSMUSP00000033898
Gene: ENSMUSG00000031502
AA Change: M1641L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 28 43 N/A INTRINSIC
internal_repeat_2 49 89 2.1e-8 PROSPERO
Pfam:Collagen 103 163 6.1e-11 PFAM
Pfam:Collagen 167 225 7.8e-10 PFAM
low complexity region 232 248 N/A INTRINSIC
Pfam:Collagen 274 334 1.7e-11 PFAM
low complexity region 356 389 N/A INTRINSIC
low complexity region 404 426 N/A INTRINSIC
low complexity region 435 455 N/A INTRINSIC
Pfam:Collagen 472 533 7.3e-12 PFAM
Pfam:Collagen 539 597 4.8e-9 PFAM
low complexity region 600 636 N/A INTRINSIC
Pfam:Collagen 642 689 4.5e-8 PFAM
Pfam:Collagen 689 746 3.5e-8 PFAM
Pfam:Collagen 736 800 2.2e-9 PFAM
Pfam:Collagen 837 896 5.2e-11 PFAM
Pfam:Collagen 882 940 1.9e-10 PFAM
Pfam:Collagen 943 1007 1.7e-10 PFAM
Pfam:Collagen 996 1058 2e-9 PFAM
Pfam:Collagen 1057 1121 1.5e-10 PFAM
low complexity region 1133 1148 N/A INTRINSIC
Pfam:Collagen 1174 1233 8.6e-11 PFAM
low complexity region 1236 1266 N/A INTRINSIC
Pfam:Collagen 1269 1337 1e-8 PFAM
Pfam:Collagen 1290 1354 2.2e-9 PFAM
Pfam:Collagen 1384 1443 1e-10 PFAM
C4 1445 1554 3.49e-65 SMART
C4 1555 1668 1.53e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151014
Predicted Effect probably benign
Transcript: ENSMUST00000209598
Predicted Effect probably benign
Transcript: ENSMUST00000209735
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the type IV collagens, an essential component of basement membranes. The encoded protein forms a triple helical heterotrimer comprised of two alpha-1 and one alpha-2 subunits that assembles into a type IV collagen network. This gene is located adjacent to the gene encoding alpha-2 subunit. Mice lacking both the alpha-1 and alpha-2 subunits of collagen IV die in utero due to structural deficiencies in the basement membranes and certain mutations in this gene cause perinatal cerebral hemorrhage and porencephaly. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice with ENU induced alleles have various eye and vision defects and may show bruising at birth. Mice carrying the G498V mutation have renal glomerular defects that resolve within the first weeks of life, but show retinal tortuosity, muscular dystrophy, brain hemorrhages, and renal cysts as adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T C 5: 8,130,514 M528V possibly damaging Het
Ano3 T A 2: 110,770,959 Y318F probably damaging Het
Asic4 T A 1: 75,451,227 D132E probably damaging Het
Atp2b2 A G 6: 113,797,108 probably null Het
Cast T C 13: 74,728,413 E447G probably damaging Het
Ccdc110 T C 8: 45,942,389 I439T probably damaging Het
Ccdc129 T C 6: 55,968,060 S589P probably benign Het
Ccdc50 A T 16: 27,444,544 R264S probably damaging Het
Chd9 T A 8: 90,933,519 V369E probably benign Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Crtac1 A G 19: 42,333,947 V118A probably damaging Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Ehmt1 A T 2: 24,884,335 probably null Het
Emc1 T A 4: 139,363,185 L412* probably null Het
Ep400 T C 5: 110,756,523 N70S possibly damaging Het
Ercc6l2 T C 13: 63,870,735 probably benign Het
Fam69c A T 18: 84,730,687 T137S probably damaging Het
Fry T C 5: 150,413,349 V1395A probably benign Het
Gm281 T A 14: 13,865,990 K300* probably null Het
Gps1 A G 11: 120,786,433 N186S possibly damaging Het
Hdgf T A 3: 87,914,228 D128E probably benign Het
Hipk3 A G 2: 104,470,762 S362P probably damaging Het
Hypk C A 2: 121,458,202 H116Q possibly damaging Het
Ifna9 T A 4: 88,592,271 T39S possibly damaging Het
Itgae A C 11: 73,116,143 D405A probably damaging Het
Kdm5a T C 6: 120,381,664 S223P probably benign Het
Kif21a C T 15: 90,937,294 S1432N possibly damaging Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Lrrn2 A G 1: 132,938,492 S432G probably benign Het
Mlana T A 19: 29,704,698 S50R probably damaging Het
Mycbp2 A T 14: 103,126,713 H4383Q probably damaging Het
Ncor1 A G 11: 62,325,616 S1469P probably damaging Het
Nol6 G T 4: 41,121,531 F270L probably benign Het
Nr2c2 T A 6: 92,160,401 M431K probably damaging Het
Nrap T C 19: 56,380,256 I243V probably damaging Het
Obscn T C 11: 59,060,928 I4297V possibly damaging Het
Olfr1056 T C 2: 86,355,861 I174V probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Palb2 A T 7: 122,117,360 probably null Het
Plod1 T C 4: 147,915,823 K260E possibly damaging Het
Rgsl1 T C 1: 153,804,130 probably null Het
Rpe65 T A 3: 159,604,400 F103L probably benign Het
Ryr3 C T 2: 112,841,873 A1438T possibly damaging Het
Slc17a3 G A 13: 23,858,054 V402M possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Snph C T 2: 151,593,511 C430Y probably damaging Het
Tarbp1 T C 8: 126,440,771 I1101V probably benign Het
Tatdn1 G A 15: 58,921,171 L120F possibly damaging Het
Trav3-3 A G 14: 53,666,371 K49E probably benign Het
Trpv5 T C 6: 41,653,249 T636A probably benign Het
Ube2l6 A G 2: 84,809,074 D127G possibly damaging Het
Usp33 T A 3: 152,374,791 probably null Het
Usp53 A T 3: 122,934,305 F876Y probably benign Het
Utrn A T 10: 12,739,479 I316K probably benign Het
Zfp106 G T 2: 120,534,856 Q357K probably damaging Het
Zfp143 T C 7: 110,074,191 V138A probably damaging Het
Zfp451 T C 1: 33,779,045 R118G probably null Het
Other mutations in Col4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Col4a1 APN 8 11240077 splice site probably benign
IGL00503:Col4a1 APN 8 11240076 splice site probably benign
IGL00938:Col4a1 APN 8 11236456 intron probably benign
IGL01295:Col4a1 APN 8 11236075 intron probably benign
IGL01406:Col4a1 APN 8 11218898 missense probably damaging 1.00
IGL01807:Col4a1 APN 8 11247056 utr 5 prime probably benign
IGL01865:Col4a1 APN 8 11201790 utr 3 prime probably benign
IGL02166:Col4a1 APN 8 11244509 unclassified probably benign
IGL02234:Col4a1 APN 8 11216713 missense probably damaging 1.00
IGL02445:Col4a1 APN 8 11233911 intron probably benign
IGL02719:Col4a1 APN 8 11231950 intron probably benign
IGL02817:Col4a1 APN 8 11220259 missense probably damaging 1.00
IGL02821:Col4a1 APN 8 11221375 missense probably benign 0.04
IGL02870:Col4a1 APN 8 11221375 missense probably benign 0.04
IGL02935:Col4a1 APN 8 11219166 missense probably damaging 1.00
IGL03085:Col4a1 APN 8 11222198 nonsense probably null
Wayne UTSW 8 11209650 missense probably damaging 1.00
IGL03134:Col4a1 UTSW 8 11240069 critical splice acceptor site probably null
R0076:Col4a1 UTSW 8 11218713 missense probably damaging 1.00
R0076:Col4a1 UTSW 8 11218713 missense probably damaging 1.00
R0238:Col4a1 UTSW 8 11218780 splice site probably benign
R0239:Col4a1 UTSW 8 11218780 splice site probably benign
R0268:Col4a1 UTSW 8 11267588 splice site probably benign
R0320:Col4a1 UTSW 8 11242782 splice site probably null
R0402:Col4a1 UTSW 8 11199838 utr 3 prime probably benign
R0483:Col4a1 UTSW 8 11236423 splice site probably benign
R0511:Col4a1 UTSW 8 11208333 critical splice acceptor site probably null
R0544:Col4a1 UTSW 8 11226487 intron probably benign
R0630:Col4a1 UTSW 8 11199889 splice site probably benign
R0648:Col4a1 UTSW 8 11246892 missense unknown
R0733:Col4a1 UTSW 8 11218934 missense possibly damaging 0.46
R0839:Col4a1 UTSW 8 11221015 missense probably damaging 0.96
R0900:Col4a1 UTSW 8 11218014 small deletion probably benign
R0941:Col4a1 UTSW 8 11208296 missense unknown
R1456:Col4a1 UTSW 8 11242829 splice site probably benign
R1728:Col4a1 UTSW 8 11212712 missense possibly damaging 0.81
R1832:Col4a1 UTSW 8 11214644 splice site probably benign
R1862:Col4a1 UTSW 8 11226439 intron probably benign
R1955:Col4a1 UTSW 8 11208228 splice site probably null
R2058:Col4a1 UTSW 8 11210792 missense probably damaging 0.96
R2263:Col4a1 UTSW 8 11312586 unclassified probably benign
R2696:Col4a1 UTSW 8 11235092 splice site probably null
R3826:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3828:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3829:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3830:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3980:Col4a1 UTSW 8 11239155 intron probably benign
R4120:Col4a1 UTSW 8 11206263 missense unknown
R4152:Col4a1 UTSW 8 11217227 intron probably null
R4437:Col4a1 UTSW 8 11206387 nonsense probably null
R5237:Col4a1 UTSW 8 11245068 unclassified probably benign
R5362:Col4a1 UTSW 8 11245760 unclassified probably benign
R5488:Col4a1 UTSW 8 11312550 unclassified probably benign
R5489:Col4a1 UTSW 8 11312550 unclassified probably benign
R5864:Col4a1 UTSW 8 11202973 utr 3 prime probably benign
R5929:Col4a1 UTSW 8 11216788 missense probably benign 0.17
R6159:Col4a1 UTSW 8 11220007 missense probably damaging 1.00
R6261:Col4a1 UTSW 8 11207409 splice site probably null
R6404:Col4a1 UTSW 8 11207409 splice site probably null
R6520:Col4a1 UTSW 8 11219152 missense probably damaging 1.00
R6862:Col4a1 UTSW 8 11202926 utr 3 prime probably benign
R6974:Col4a1 UTSW 8 11312538 unclassified probably benign
R7329:Col4a1 UTSW 8 11226494 critical splice acceptor site probably null
Z1088:Col4a1 UTSW 8 11246859 splice site probably benign
Predicted Primers PCR Primer
(F):5'- AGCACATTCATCTACAAATGGC -3'
(R):5'- AGACTCATGCCTTATGCTTGTC -3'

Sequencing Primer
(F):5'- CAAATGGCAAATGACCTCTTTTC -3'
(R):5'- ATGCTTGTCCCACAGCAC -3'
Posted On2015-04-17