Incidental Mutation 'R3923:Itgae'
ID307050
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Nameintegrin alpha E, epithelial-associated
SynonymsCD103, alpha-E1
MMRRC Submission 040820-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3923 (G1)
Quality Score200
Status Not validated
Chromosome11
Chromosomal Location73090583-73147446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 73116143 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 405 (D405A)
Ref Sequence ENSEMBL: ENSMUSP00000006101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]
Predicted Effect probably damaging
Transcript: ENSMUST00000006101
AA Change: D405A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: D405A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102537
AA Change: D405A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: D405A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T C 5: 8,130,514 M528V possibly damaging Het
Ano3 T A 2: 110,770,959 Y318F probably damaging Het
Asic4 T A 1: 75,451,227 D132E probably damaging Het
Atp2b2 A G 6: 113,797,108 probably null Het
Cast T C 13: 74,728,413 E447G probably damaging Het
Ccdc110 T C 8: 45,942,389 I439T probably damaging Het
Ccdc129 T C 6: 55,968,060 S589P probably benign Het
Ccdc50 A T 16: 27,444,544 R264S probably damaging Het
Chd9 T A 8: 90,933,519 V369E probably benign Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Col4a1 T A 8: 11,201,665 probably benign Het
Crtac1 A G 19: 42,333,947 V118A probably damaging Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Ehmt1 A T 2: 24,884,335 probably null Het
Emc1 T A 4: 139,363,185 L412* probably null Het
Ep400 T C 5: 110,756,523 N70S possibly damaging Het
Ercc6l2 T C 13: 63,870,735 probably benign Het
Fam69c A T 18: 84,730,687 T137S probably damaging Het
Fry T C 5: 150,413,349 V1395A probably benign Het
Gm281 T A 14: 13,865,990 K300* probably null Het
Gps1 A G 11: 120,786,433 N186S possibly damaging Het
Hdgf T A 3: 87,914,228 D128E probably benign Het
Hipk3 A G 2: 104,470,762 S362P probably damaging Het
Hypk C A 2: 121,458,202 H116Q possibly damaging Het
Ifna9 T A 4: 88,592,271 T39S possibly damaging Het
Kdm5a T C 6: 120,381,664 S223P probably benign Het
Kif21a C T 15: 90,937,294 S1432N possibly damaging Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Lrrn2 A G 1: 132,938,492 S432G probably benign Het
Mlana T A 19: 29,704,698 S50R probably damaging Het
Mycbp2 A T 14: 103,126,713 H4383Q probably damaging Het
Ncor1 A G 11: 62,325,616 S1469P probably damaging Het
Nol6 G T 4: 41,121,531 F270L probably benign Het
Nr2c2 T A 6: 92,160,401 M431K probably damaging Het
Nrap T C 19: 56,380,256 I243V probably damaging Het
Obscn T C 11: 59,060,928 I4297V possibly damaging Het
Olfr1056 T C 2: 86,355,861 I174V probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Palb2 A T 7: 122,117,360 probably null Het
Plod1 T C 4: 147,915,823 K260E possibly damaging Het
Rgsl1 T C 1: 153,804,130 probably null Het
Rpe65 T A 3: 159,604,400 F103L probably benign Het
Ryr3 C T 2: 112,841,873 A1438T possibly damaging Het
Slc17a3 G A 13: 23,858,054 V402M possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Snph C T 2: 151,593,511 C430Y probably damaging Het
Tarbp1 T C 8: 126,440,771 I1101V probably benign Het
Tatdn1 G A 15: 58,921,171 L120F possibly damaging Het
Trav3-3 A G 14: 53,666,371 K49E probably benign Het
Trpv5 T C 6: 41,653,249 T636A probably benign Het
Ube2l6 A G 2: 84,809,074 D127G possibly damaging Het
Usp33 T A 3: 152,374,791 probably null Het
Usp53 A T 3: 122,934,305 F876Y probably benign Het
Utrn A T 10: 12,739,479 I316K probably benign Het
Zfp106 G T 2: 120,534,856 Q357K probably damaging Het
Zfp143 T C 7: 110,074,191 V138A probably damaging Het
Zfp451 T C 1: 33,779,045 R118G probably null Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73145635 missense probably benign 0.17
IGL00472:Itgae APN 11 73113694 missense probably benign 0.06
IGL00821:Itgae APN 11 73123148 missense probably damaging 1.00
IGL01625:Itgae APN 11 73119437 missense probably benign 0.00
IGL01639:Itgae APN 11 73119378 missense probably benign 0.00
IGL01743:Itgae APN 11 73111759 missense probably benign 0.02
IGL01911:Itgae APN 11 73116137 missense probably damaging 1.00
IGL01949:Itgae APN 11 73118184 missense probably benign 0.29
IGL02149:Itgae APN 11 73103894 missense probably benign 0.04
IGL02179:Itgae APN 11 73134018 missense probably benign 0.06
IGL02231:Itgae APN 11 73090622 missense possibly damaging 0.88
IGL02292:Itgae APN 11 73118535 missense probably damaging 0.98
IGL02378:Itgae APN 11 73118121 missense probably benign 0.00
IGL02525:Itgae APN 11 73130951 missense probably damaging 0.98
IGL02576:Itgae APN 11 73118505 missense possibly damaging 0.95
IGL02729:Itgae APN 11 73118203 splice site probably benign
IGL02859:Itgae APN 11 73114867 missense probably damaging 1.00
IGL03074:Itgae APN 11 73125310 missense probably benign 0.00
IGL03107:Itgae APN 11 73113601 missense probably damaging 1.00
IGL03264:Itgae APN 11 73115574 missense possibly damaging 0.73
IGL03272:Itgae APN 11 73133854 splice site probably null
IGL03352:Itgae APN 11 73131730 missense probably damaging 1.00
R0134:Itgae UTSW 11 73111342 missense probably benign 0.00
R0225:Itgae UTSW 11 73111342 missense probably benign 0.00
R0320:Itgae UTSW 11 73130999 missense possibly damaging 0.74
R0344:Itgae UTSW 11 73118147 missense probably benign 0.13
R0403:Itgae UTSW 11 73123183 missense possibly damaging 0.89
R0631:Itgae UTSW 11 73114907 missense probably damaging 1.00
R0833:Itgae UTSW 11 73129206 missense probably benign 0.02
R0836:Itgae UTSW 11 73129206 missense probably benign 0.02
R0973:Itgae UTSW 11 73138509 nonsense probably null
R1231:Itgae UTSW 11 73119379 missense probably benign 0.02
R1389:Itgae UTSW 11 73125362 missense probably damaging 1.00
R1433:Itgae UTSW 11 73115592 missense probably damaging 1.00
R1534:Itgae UTSW 11 73145605 missense possibly damaging 0.58
R1833:Itgae UTSW 11 73117162 missense possibly damaging 0.94
R1914:Itgae UTSW 11 73118643 splice site probably benign
R1915:Itgae UTSW 11 73118643 splice site probably benign
R2061:Itgae UTSW 11 73118622 missense probably benign 0.00
R2380:Itgae UTSW 11 73145569 missense probably benign 0.00
R2435:Itgae UTSW 11 73121937 nonsense probably null
R2680:Itgae UTSW 11 73114926 missense probably damaging 1.00
R2886:Itgae UTSW 11 73140687 missense probably benign 0.04
R3873:Itgae UTSW 11 73113616 missense probably damaging 1.00
R4010:Itgae UTSW 11 73111339 missense probably benign 0.00
R4059:Itgae UTSW 11 73112134 missense probably benign
R4212:Itgae UTSW 11 73119352 missense probably benign
R4213:Itgae UTSW 11 73119352 missense probably benign
R4691:Itgae UTSW 11 73119519 nonsense probably null
R4736:Itgae UTSW 11 73114880 missense possibly damaging 0.79
R5152:Itgae UTSW 11 73130995 missense probably damaging 1.00
R5201:Itgae UTSW 11 73110556 missense probably benign 0.00
R5307:Itgae UTSW 11 73145638 missense probably benign 0.00
R5362:Itgae UTSW 11 73111849 missense probably damaging 1.00
R5448:Itgae UTSW 11 73133908 critical splice donor site probably null
R5645:Itgae UTSW 11 73129248 missense probably damaging 1.00
R5672:Itgae UTSW 11 73145551 missense possibly damaging 0.96
R6079:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6138:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6226:Itgae UTSW 11 73140757 missense probably benign 0.11
R6244:Itgae UTSW 11 73145601 missense probably damaging 0.96
R6326:Itgae UTSW 11 73131693 missense possibly damaging 0.88
R6332:Itgae UTSW 11 73111402 splice site probably null
R6502:Itgae UTSW 11 73145592 missense probably benign 0.10
R6825:Itgae UTSW 11 73118496 missense possibly damaging 0.89
R7016:Itgae UTSW 11 73119516 missense probably damaging 0.99
R7020:Itgae UTSW 11 73111369 missense probably damaging 1.00
R7069:Itgae UTSW 11 73116143 missense probably damaging 0.99
R7132:Itgae UTSW 11 73111358 missense possibly damaging 0.93
R7473:Itgae UTSW 11 73140678 missense possibly damaging 0.87
R7599:Itgae UTSW 11 73121960 missense possibly damaging 0.62
R7637:Itgae UTSW 11 73113631 missense probably damaging 1.00
R7763:Itgae UTSW 11 73123269 critical splice donor site probably null
R7829:Itgae UTSW 11 73138792 missense probably benign
R7860:Itgae UTSW 11 73120273 critical splice acceptor site probably null
R7978:Itgae UTSW 11 73134087 missense probably damaging 0.98
R8197:Itgae UTSW 11 73120384 missense probably benign
U15987:Itgae UTSW 11 73115574 missense possibly damaging 0.73
X0024:Itgae UTSW 11 73111376 missense probably benign 0.01
Z1186:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1186:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1186:Itgae UTSW 11 73115640 missense probably benign
Z1186:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1186:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1186:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1186:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1187:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1187:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1187:Itgae UTSW 11 73115640 missense probably benign
Z1187:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1187:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1187:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1187:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1188:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1188:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1188:Itgae UTSW 11 73115640 missense probably benign
Z1188:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1188:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1188:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1188:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1189:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1189:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1189:Itgae UTSW 11 73115640 missense probably benign
Z1189:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1189:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1189:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1189:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1190:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1190:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1190:Itgae UTSW 11 73115640 missense probably benign
Z1190:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1190:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1190:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1190:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1191:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1191:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1191:Itgae UTSW 11 73115640 missense probably benign
Z1191:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1191:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1191:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1191:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1192:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1192:Itgae UTSW 11 73115640 missense probably benign
Z1192:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1192:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1192:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1192:Itgae UTSW 11 73134127 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CCCTGACTCTATGAAGCTCTGC -3'
(R):5'- GCCGAATCTCAGTCCATACAG -3'

Sequencing Primer
(F):5'- GTGCACTGTTCCTCCAAATAGCATAG -3'
(R):5'- GAATGTCCCAATCCTTTAAGCAC -3'
Posted On2015-04-17