Incidental Mutation 'R3923:Gm281'
ID307057
Institutional Source Beutler Lab
Gene Symbol Gm281
Ensembl Gene ENSMUSG00000084902
Gene Namepredicted gene 281
SynonymsLOC238939
MMRRC Submission 040820-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3923 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location13814618-13914478 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 13865990 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 300 (K300*)
Ref Sequence ENSEMBL: ENSMUSP00000121887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144914]
Predicted Effect probably null
Transcript: ENSMUST00000144914
AA Change: K300*
SMART Domains Protein: ENSMUSP00000121887
Gene: ENSMUSG00000084902
AA Change: K300*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 32 127 3.45e-2 SMART
CA 156 230 7.87e-9 SMART
CA 274 352 1.36e-3 SMART
CA 376 470 6.99e-3 SMART
CA 492 563 8.69e-11 SMART
CA 589 683 2.09e-1 SMART
transmembrane domain 705 727 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157171
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T C 5: 8,130,514 M528V possibly damaging Het
Ano3 T A 2: 110,770,959 Y318F probably damaging Het
Asic4 T A 1: 75,451,227 D132E probably damaging Het
Atp2b2 A G 6: 113,797,108 probably null Het
Cast T C 13: 74,728,413 E447G probably damaging Het
Ccdc110 T C 8: 45,942,389 I439T probably damaging Het
Ccdc129 T C 6: 55,968,060 S589P probably benign Het
Ccdc50 A T 16: 27,444,544 R264S probably damaging Het
Chd9 T A 8: 90,933,519 V369E probably benign Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Col4a1 T A 8: 11,201,665 probably benign Het
Crtac1 A G 19: 42,333,947 V118A probably damaging Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Ehmt1 A T 2: 24,884,335 probably null Het
Emc1 T A 4: 139,363,185 L412* probably null Het
Ep400 T C 5: 110,756,523 N70S possibly damaging Het
Ercc6l2 T C 13: 63,870,735 probably benign Het
Fam69c A T 18: 84,730,687 T137S probably damaging Het
Fry T C 5: 150,413,349 V1395A probably benign Het
Gps1 A G 11: 120,786,433 N186S possibly damaging Het
Hdgf T A 3: 87,914,228 D128E probably benign Het
Hipk3 A G 2: 104,470,762 S362P probably damaging Het
Hypk C A 2: 121,458,202 H116Q possibly damaging Het
Ifna9 T A 4: 88,592,271 T39S possibly damaging Het
Itgae A C 11: 73,116,143 D405A probably damaging Het
Kdm5a T C 6: 120,381,664 S223P probably benign Het
Kif21a C T 15: 90,937,294 S1432N possibly damaging Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Lrrn2 A G 1: 132,938,492 S432G probably benign Het
Mlana T A 19: 29,704,698 S50R probably damaging Het
Mycbp2 A T 14: 103,126,713 H4383Q probably damaging Het
Ncor1 A G 11: 62,325,616 S1469P probably damaging Het
Nol6 G T 4: 41,121,531 F270L probably benign Het
Nr2c2 T A 6: 92,160,401 M431K probably damaging Het
Nrap T C 19: 56,380,256 I243V probably damaging Het
Obscn T C 11: 59,060,928 I4297V possibly damaging Het
Olfr1056 T C 2: 86,355,861 I174V probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Palb2 A T 7: 122,117,360 probably null Het
Plod1 T C 4: 147,915,823 K260E possibly damaging Het
Rgsl1 T C 1: 153,804,130 probably null Het
Rpe65 T A 3: 159,604,400 F103L probably benign Het
Ryr3 C T 2: 112,841,873 A1438T possibly damaging Het
Slc17a3 G A 13: 23,858,054 V402M possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Snph C T 2: 151,593,511 C430Y probably damaging Het
Tarbp1 T C 8: 126,440,771 I1101V probably benign Het
Tatdn1 G A 15: 58,921,171 L120F possibly damaging Het
Trav3-3 A G 14: 53,666,371 K49E probably benign Het
Trpv5 T C 6: 41,653,249 T636A probably benign Het
Ube2l6 A G 2: 84,809,074 D127G possibly damaging Het
Usp33 T A 3: 152,374,791 probably null Het
Usp53 A T 3: 122,934,305 F876Y probably benign Het
Utrn A T 10: 12,739,479 I316K probably benign Het
Zfp106 G T 2: 120,534,856 Q357K probably damaging Het
Zfp143 T C 7: 110,074,191 V138A probably damaging Het
Zfp451 T C 1: 33,779,045 R118G probably null Het
Other mutations in Gm281
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0115:Gm281 UTSW 14 13899571 missense probably damaging 0.99
R0842:Gm281 UTSW 14 13856686 missense probably benign 0.16
R1252:Gm281 UTSW 14 13862444 missense probably benign 0.00
R1275:Gm281 UTSW 14 13896949 missense probably damaging 1.00
R1631:Gm281 UTSW 14 13829796 missense probably damaging 0.99
R1831:Gm281 UTSW 14 13899619 missense probably damaging 1.00
R1885:Gm281 UTSW 14 13828607 missense probably damaging 1.00
R1886:Gm281 UTSW 14 13828607 missense probably damaging 1.00
R1887:Gm281 UTSW 14 13828607 missense probably damaging 1.00
R1903:Gm281 UTSW 14 13829657 missense possibly damaging 0.94
R1940:Gm281 UTSW 14 13828582 missense probably null 0.95
R2324:Gm281 UTSW 14 13868077 missense probably damaging 1.00
R4193:Gm281 UTSW 14 13914416 missense probably benign 0.02
R4195:Gm281 UTSW 14 13829772 missense probably benign 0.05
R4370:Gm281 UTSW 14 13862375 missense probably benign 0.03
R4675:Gm281 UTSW 14 13856724 missense probably benign 0.32
R4734:Gm281 UTSW 14 13845292 missense probably benign 0.13
R5387:Gm281 UTSW 14 13914438 start codon destroyed probably null 0.82
R6037:Gm281 UTSW 14 13864282 missense probably damaging 1.00
R6037:Gm281 UTSW 14 13864282 missense probably damaging 1.00
R6177:Gm281 UTSW 14 13868002 missense probably benign 0.08
R7051:Gm281 UTSW 14 13828486 missense
R7205:Gm281 UTSW 14 13866032 missense
R7258:Gm281 UTSW 14 13899648 missense
R7833:Gm281 UTSW 14 13896968 splice site probably null
R8309:Gm281 UTSW 14 13814954 nonsense probably null
Z1177:Gm281 UTSW 14 13823754 missense
Z1177:Gm281 UTSW 14 13845421 missense
Predicted Primers PCR Primer
(F):5'- ATTTGGTCCTGAGGTAGAATAGAG -3'
(R):5'- ACGGGGTCTTGAGAGTTACC -3'

Sequencing Primer
(F):5'- TGGTCCTGAGGTAGAATAGAGTTGAG -3'
(R):5'- CGGGGTCTTGAGAGTTACCTTCAC -3'
Posted On2015-04-17