Incidental Mutation 'R3924:Lpcat4'
ID307074
Institutional Source Beutler Lab
Gene Symbol Lpcat4
Ensembl Gene ENSMUSG00000027134
Gene Namelysophosphatidylcholine acyltransferase 4
SynonymsAytl3, LPEAT2, Agpat7
MMRRC Submission 040915-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #R3924 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location112239468-112247111 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 112246716 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 468 (Q468H)
Ref Sequence ENSEMBL: ENSMUSP00000028554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028554] [ENSMUST00000043970]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028554
AA Change: Q468H

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028554
Gene: ENSMUSG00000027134
AA Change: Q468H

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 92 113 N/A INTRINSIC
PlsC 123 234 5.73e-24 SMART
low complexity region 411 422 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043970
SMART Domains Protein: ENSMUSP00000048263
Gene: ENSMUSG00000041358

DomainStartEndE-ValueType
Pfam:NUT 14 541 1.4e-210 PFAM
low complexity region 840 854 N/A INTRINSIC
Pfam:NUT 900 1123 6.7e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136219
Meta Mutation Damage Score 0.1469 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the 1-acylglycerol-3-phosphate O-acyltransferase (EC 2.3.1.51) family, such as AGPAT7, catalyze the conversion of lysophosphatidic acid (LPA) to phosphatidic acid (PA), a precursor in the biosynthesis of all glycerolipids. Both LPA and PA are involved in signal transduction (Ye et al., 2005 [PubMed 16243729]).[supplied by OMIM, May 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik G T 9: 53,432,405 V119F probably benign Het
Agtpbp1 A T 13: 59,500,407 V533D probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Aldh3b3 A G 19: 3,968,491 N402S probably damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
Arpin A G 7: 79,929,687 Y63H probably benign Het
Brinp2 A G 1: 158,246,208 L781P probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Csad T C 15: 102,178,556 S427G probably benign Het
Dach1 A G 14: 97,915,903 V443A probably damaging Het
Dlat A G 9: 50,658,190 S160P possibly damaging Het
Dpf1 A G 7: 29,311,673 R165G possibly damaging Het
Dtd2 G C 12: 52,004,951 probably null Het
Fa2h A G 8: 111,393,515 Y80H probably damaging Het
Flii A G 11: 60,720,076 F509S probably damaging Het
Fmo9 A G 1: 166,664,652 S350P probably benign Het
Gabra4 A G 5: 71,642,253 probably benign Het
Gm3604 A G 13: 62,370,230 S105P probably damaging Het
Gpr155 T A 2: 73,370,076 L362F probably damaging Het
Lmbrd2 T C 15: 9,149,537 V86A probably benign Het
Luzp1 T C 4: 136,542,857 I797T probably damaging Het
Myh8 A T 11: 67,297,137 I912F probably damaging Het
Notch2 G T 3: 98,122,034 G1038* probably null Het
Nptx1 G T 11: 119,547,507 T28N possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Plekha5 A G 6: 140,570,379 N317S possibly damaging Het
Polr1a A G 6: 71,929,450 M417V probably benign Het
Ptpn13 T C 5: 103,550,741 probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rasd2 A G 8: 75,221,974 N176S probably damaging Het
Rsbn1l A G 5: 20,919,787 V339A probably damaging Het
Ryr3 A G 2: 113,028,703 probably benign Het
Shkbp1 A G 7: 27,342,402 W676R probably benign Het
Sipa1 G A 19: 5,660,379 T201I probably benign Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Usp28 T C 9: 49,030,923 probably null Het
Zfp946 G T 17: 22,455,701 G479C probably benign Het
Other mutations in Lpcat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01905:Lpcat4 APN 2 112243043 unclassified probably null
IGL02319:Lpcat4 APN 2 112243884 missense probably damaging 1.00
IGL02950:Lpcat4 APN 2 112244042 missense possibly damaging 0.95
IGL03046:Lpcat4 UTSW 2 112241989 synonymous silent
R0131:Lpcat4 UTSW 2 112246748 missense probably damaging 0.99
R0131:Lpcat4 UTSW 2 112246748 missense probably damaging 0.99
R0132:Lpcat4 UTSW 2 112246748 missense probably damaging 0.99
R0271:Lpcat4 UTSW 2 112243245 splice site probably null
R0884:Lpcat4 UTSW 2 112242732 missense probably damaging 1.00
R1387:Lpcat4 UTSW 2 112244676 missense probably benign
R1731:Lpcat4 UTSW 2 112243843 missense probably damaging 1.00
R1988:Lpcat4 UTSW 2 112242542 missense possibly damaging 0.80
R2047:Lpcat4 UTSW 2 112244797 critical splice donor site probably null
R4001:Lpcat4 UTSW 2 112239951 missense probably benign 0.21
R4326:Lpcat4 UTSW 2 112246392 missense probably benign 0.00
R5247:Lpcat4 UTSW 2 112242515 missense possibly damaging 0.64
R5959:Lpcat4 UTSW 2 112240035 missense possibly damaging 0.88
R7239:Lpcat4 UTSW 2 112242707 missense possibly damaging 0.77
R7434:Lpcat4 UTSW 2 112243055 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATATGGTCTGAGCACTGAGC -3'
(R):5'- TGGAAATCTGGCAACCAACC -3'

Sequencing Primer
(F):5'- CACTGAGCTGGGTTGAGAAAG -3'
(R):5'- ATAGGGTAGGCCTCTGACG -3'
Posted On2015-04-17