Incidental Mutation 'R0375:Naip1'
ID30708
Institutional Source Beutler Lab
Gene Symbol Naip1
Ensembl Gene ENSMUSG00000021640
Gene NameNLR family, apoptosis inhibitory protein 1
SynonymsBirc1a, D13Lsd1, Naip
MMRRC Submission 038581-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0375 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100407764-100452869 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100409148 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1291 (F1291L)
Ref Sequence ENSEMBL: ENSMUSP00000152583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022142] [ENSMUST00000221943] [ENSMUST00000222155]
Predicted Effect probably benign
Transcript: ENSMUST00000022142
AA Change: F1291L

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022142
Gene: ENSMUSG00000021640
AA Change: F1291L

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.18e-20 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 7.82e-26 SMART
AAA 462 603 1.14e-2 SMART
low complexity region 908 919 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221943
Predicted Effect probably benign
Transcript: ENSMUST00000222155
AA Change: F1291L

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.1054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,046,252 T4707I probably damaging Het
5730522E02Rik T A 11: 25,769,092 Y17F unknown Het
Aars2 A G 17: 45,514,550 D313G probably damaging Het
Abca9 A T 11: 110,115,447 D1277E probably benign Het
Adgrl1 G T 8: 83,934,901 A981S probably damaging Het
Aff3 T G 1: 38,204,940 K917Q possibly damaging Het
BC049715 A T 6: 136,839,996 H78L probably benign Het
Cacna1g C A 11: 94,411,054 A2027S possibly damaging Het
Camk1g G A 1: 193,356,401 probably benign Het
Carf T C 1: 60,144,002 V386A probably damaging Het
Cd46 A G 1: 195,086,164 S82P probably benign Het
Clic5 A G 17: 44,270,623 E180G possibly damaging Het
Col27a1 A G 4: 63,225,661 T529A probably benign Het
Col7a1 C T 9: 108,980,237 R2627C unknown Het
Cuzd1 G A 7: 131,311,908 probably benign Het
Cwc27 T C 13: 104,807,823 D50G possibly damaging Het
Dhx38 A G 8: 109,555,181 V735A possibly damaging Het
Dhx57 T G 17: 80,258,121 E834A probably damaging Het
Dsg4 A G 18: 20,470,879 D801G probably damaging Het
Dtx1 T C 5: 120,681,399 E578G probably damaging Het
F830016B08Rik A T 18: 60,300,193 H116L probably damaging Het
Fam208b A G 13: 3,596,842 V61A possibly damaging Het
Fbxw18 T C 9: 109,688,839 I360V possibly damaging Het
Fignl2 G A 15: 101,054,093 P103S probably benign Het
Frmpd1 A G 4: 45,284,196 T1006A probably benign Het
Ggnbp2 G T 11: 84,836,374 C545* probably null Het
Gm3336 A G 8: 70,718,645 probably benign Het
Gpr37 T C 6: 25,669,291 N518S probably benign Het
Hbs1l T A 10: 21,342,541 D312E possibly damaging Het
Hoxd10 C A 2: 74,692,720 S247R probably benign Het
Ifnb1 A T 4: 88,522,744 F11I probably benign Het
Marf1 T C 16: 14,151,320 probably benign Het
Myo1f T A 17: 33,601,956 V879E probably benign Het
Nckap1l A G 15: 103,474,159 E529G probably damaging Het
Npm3 T C 19: 45,748,229 E157G probably damaging Het
Olfr1200 T A 2: 88,767,641 T225S possibly damaging Het
Olfr1240 G T 2: 89,439,396 N294K probably benign Het
Olfr248 A G 1: 174,391,209 T47A probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Ppp6r1 A G 7: 4,633,287 V768A probably benign Het
Prrc1 A G 18: 57,362,492 T14A probably damaging Het
Ranbp2 T C 10: 58,477,283 L1275P probably damaging Het
Rnf214 C A 9: 45,899,823 V181F probably damaging Het
Ror2 T C 13: 53,132,004 N58S probably damaging Het
Selplg G A 5: 113,820,008 T79I probably damaging Het
Setd1b G A 5: 123,157,437 G1023S unknown Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Skint5 A G 4: 113,705,596 V803A unknown Het
Slc25a46 T C 18: 31,583,266 I394M possibly damaging Het
Snrnp27 A T 6: 86,680,953 I101K possibly damaging Het
Spag17 C A 3: 100,027,590 T704K probably benign Het
Tas2r144 T A 6: 42,216,124 M266K possibly damaging Het
Tbc1d31 T A 15: 57,955,350 L783H probably benign Het
Tbck C A 3: 132,751,232 probably benign Het
Vcan A G 13: 89,691,275 V2050A probably damaging Het
Vmn1r70 T A 7: 10,634,060 N158K probably damaging Het
Vmn2r103 T A 17: 19,792,859 Y81N probably benign Het
Vmn2r103 A G 17: 19,793,464 T173A probably benign Het
Ylpm1 T G 12: 85,014,980 S552A unknown Het
Zdhhc17 A T 10: 110,982,106 Y58* probably null Het
Other mutations in Naip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Naip1 APN 13 100443720 critical splice acceptor site probably null
IGL01145:Naip1 APN 13 100409121 missense probably benign 0.00
IGL01356:Naip1 APN 13 100423214 missense probably damaging 0.99
IGL01414:Naip1 APN 13 100409173 critical splice acceptor site probably null
IGL01505:Naip1 APN 13 100425933 missense probably damaging 1.00
IGL01573:Naip1 APN 13 100427382 missense probably benign 0.03
IGL01931:Naip1 APN 13 100409032 nonsense probably null
IGL02043:Naip1 APN 13 100426796 missense probably benign 0.03
IGL02097:Naip1 APN 13 100425588 missense probably benign 0.03
IGL02331:Naip1 APN 13 100426796 missense probably benign 0.03
IGL02627:Naip1 APN 13 100425648 missense possibly damaging 0.68
IGL02675:Naip1 APN 13 100409118 missense probably benign
IGL02801:Naip1 APN 13 100444368 missense probably damaging 1.00
IGL02851:Naip1 APN 13 100433262 missense probably damaging 1.00
IGL03038:Naip1 APN 13 100437333 nonsense probably null
IGL03399:Naip1 APN 13 100408918 missense probably damaging 1.00
FR4340:Naip1 UTSW 13 100423076 missense probably benign
FR4342:Naip1 UTSW 13 100425471 missense probably benign 0.00
R0051:Naip1 UTSW 13 100411001 missense probably damaging 0.96
R0095:Naip1 UTSW 13 100423083 missense probably benign 0.24
R0147:Naip1 UTSW 13 100426910 missense possibly damaging 0.67
R0442:Naip1 UTSW 13 100444516 missense probably benign 0.00
R0455:Naip1 UTSW 13 100423219 missense probably benign 0.00
R0491:Naip1 UTSW 13 100423219 missense probably benign 0.00
R0614:Naip1 UTSW 13 100444200 missense probably benign 0.00
R0785:Naip1 UTSW 13 100423076 missense probably benign
R0785:Naip1 UTSW 13 100423085 missense probably benign 0.00
R0787:Naip1 UTSW 13 100426096 missense probably benign 0.22
R1081:Naip1 UTSW 13 100423070 missense probably benign 0.21
R1177:Naip1 UTSW 13 100427064 missense possibly damaging 0.91
R1476:Naip1 UTSW 13 100426870 missense probably benign 0.35
R1672:Naip1 UTSW 13 100423149 missense probably benign 0.00
R1809:Naip1 UTSW 13 100426239 missense probably benign
R2057:Naip1 UTSW 13 100425573 missense probably damaging 0.96
R2182:Naip1 UTSW 13 100413680 missense probably benign 0.01
R2395:Naip1 UTSW 13 100423106 missense possibly damaging 0.83
R2518:Naip1 UTSW 13 100423219 missense probably benign 0.00
R3033:Naip1 UTSW 13 100432458 missense probably benign 0.01
R3122:Naip1 UTSW 13 100408995 missense probably damaging 1.00
R3439:Naip1 UTSW 13 100423219 missense probably benign 0.00
R4167:Naip1 UTSW 13 100444286 missense probably benign 0.04
R4179:Naip1 UTSW 13 100426176 missense probably damaging 0.99
R4212:Naip1 UTSW 13 100426875 splice site probably null
R4639:Naip1 UTSW 13 100444283 missense probably benign 0.31
R4674:Naip1 UTSW 13 100444174 missense probably damaging 1.00
R4736:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R4740:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R4778:Naip1 UTSW 13 100426648 missense probably damaging 1.00
R4806:Naip1 UTSW 13 100425621 missense probably benign 0.00
R4855:Naip1 UTSW 13 100423220 splice site probably null
R5740:Naip1 UTSW 13 100432501 critical splice acceptor site probably null
R5797:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R5806:Naip1 UTSW 13 100444735 start codon destroyed probably null 1.00
R5895:Naip1 UTSW 13 100423128 missense probably benign 0.00
R5896:Naip1 UTSW 13 100423128 missense probably benign 0.00
R6023:Naip1 UTSW 13 100426186 missense probably benign 0.00
R6109:Naip1 UTSW 13 100427182 missense probably damaging 1.00
R6117:Naip1 UTSW 13 100444737 start codon destroyed probably damaging 0.99
R6133:Naip1 UTSW 13 100444643 missense probably benign 0.10
R6241:Naip1 UTSW 13 100425661 missense probably damaging 0.99
R6335:Naip1 UTSW 13 100426552 missense probably damaging 1.00
R6404:Naip1 UTSW 13 100423219 missense probably benign 0.00
R6475:Naip1 UTSW 13 100409088 missense probably damaging 1.00
R6508:Naip1 UTSW 13 100436465 missense probably damaging 1.00
R6580:Naip1 UTSW 13 100444649 missense probably damaging 0.99
R6600:Naip1 UTSW 13 100423070 missense probably benign 0.21
R6600:Naip1 UTSW 13 100423158 missense probably benign 0.00
R6603:Naip1 UTSW 13 100423070 missense probably benign 0.21
R6603:Naip1 UTSW 13 100423158 missense probably benign 0.00
R6633:Naip1 UTSW 13 100423076 missense probably benign
R6633:Naip1 UTSW 13 100423085 missense probably benign 0.00
R6720:Naip1 UTSW 13 100423077 missense probably benign 0.00
R6805:Naip1 UTSW 13 100427341 missense probably benign 0.04
R7043:Naip1 UTSW 13 100426914 missense probably damaging 1.00
R7615:Naip1 UTSW 13 100425776 missense probably benign 0.00
R7797:Naip1 UTSW 13 100444478 missense probably damaging 1.00
R7820:Naip1 UTSW 13 100423070 missense probably benign 0.21
R7842:Naip1 UTSW 13 100426998 missense probably damaging 1.00
R8117:Naip1 UTSW 13 100427001 missense possibly damaging 0.67
R8132:Naip1 UTSW 13 100437375 missense possibly damaging 0.84
R8177:Naip1 UTSW 13 100427403 missense probably benign 0.00
R8203:Naip1 UTSW 13 100425820 missense probably benign 0.02
R8283:Naip1 UTSW 13 100427187 missense probably damaging 1.00
R8319:Naip1 UTSW 13 100429213 missense probably benign 0.13
R8377:Naip1 UTSW 13 100425866 missense possibly damaging 0.53
R8864:Naip1 UTSW 13 100426320 missense possibly damaging 0.55
R8871:Naip1 UTSW 13 100443638 missense probably damaging 1.00
RF007:Naip1 UTSW 13 100426134 missense probably benign 0.03
X0066:Naip1 UTSW 13 100437322 missense probably damaging 1.00
Y4335:Naip1 UTSW 13 100425522 missense probably benign 0.00
Y4336:Naip1 UTSW 13 100425522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGGTGGCCTGAACTTGAATGC -3'
(R):5'- TGTACTGTACCCTGGTCCATACCTG -3'

Sequencing Primer
(F):5'- AGGTTGTCCAGGGCTTGAAA -3'
(R):5'- CATATGTCCTCCTGTGAGACAGAG -3'
Posted On2013-04-24