Incidental Mutation 'R3924:Gabra4'
ID307082
Institutional Source Beutler Lab
Gene Symbol Gabra4
Ensembl Gene ENSMUSG00000029211
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 4
SynonymsGabra-4
MMRRC Submission 040915-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3924 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location71569749-71658308 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 71642253 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031121] [ENSMUST00000197994] [ENSMUST00000198138] [ENSMUST00000199357]
Predicted Effect probably benign
Transcript: ENSMUST00000031121
SMART Domains Protein: ENSMUSP00000031121
Gene: ENSMUSG00000029211

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Neur_chan_LBD 48 256 8.8e-52 PFAM
Pfam:Neur_chan_memb 263 536 3.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197994
Predicted Effect probably benign
Transcript: ENSMUST00000198138
SMART Domains Protein: ENSMUSP00000142466
Gene: ENSMUSG00000029211

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SCOP:d1i9ba_ 53 69 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199357
SMART Domains Protein: ENSMUSP00000143675
Gene: ENSMUSG00000029211

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Neur_chan_LBD 91 282 1.7e-45 PFAM
Pfam:Neur_chan_memb 289 562 3.3e-44 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. This gene encodes subunit alpha-4, which is involved in the etiology of autism and eventually increases autism risk through interaction with another subunit, gamma-aminobutyric acid receptor beta-1 (GABRB1). Alternatively spliced transcript variants encoding different isoforms have been found in this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik G T 9: 53,432,405 V119F probably benign Het
Agtpbp1 A T 13: 59,500,407 V533D probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Aldh3b3 A G 19: 3,968,491 N402S probably damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
Arpin A G 7: 79,929,687 Y63H probably benign Het
Brinp2 A G 1: 158,246,208 L781P probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Csad T C 15: 102,178,556 S427G probably benign Het
Dach1 A G 14: 97,915,903 V443A probably damaging Het
Dlat A G 9: 50,658,190 S160P possibly damaging Het
Dpf1 A G 7: 29,311,673 R165G possibly damaging Het
Dtd2 G C 12: 52,004,951 probably null Het
Fa2h A G 8: 111,393,515 Y80H probably damaging Het
Flii A G 11: 60,720,076 F509S probably damaging Het
Fmo9 A G 1: 166,664,652 S350P probably benign Het
Gm3604 A G 13: 62,370,230 S105P probably damaging Het
Gpr155 T A 2: 73,370,076 L362F probably damaging Het
Lmbrd2 T C 15: 9,149,537 V86A probably benign Het
Lpcat4 G T 2: 112,246,716 Q468H possibly damaging Het
Luzp1 T C 4: 136,542,857 I797T probably damaging Het
Myh8 A T 11: 67,297,137 I912F probably damaging Het
Notch2 G T 3: 98,122,034 G1038* probably null Het
Nptx1 G T 11: 119,547,507 T28N possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Plekha5 A G 6: 140,570,379 N317S possibly damaging Het
Polr1a A G 6: 71,929,450 M417V probably benign Het
Ptpn13 T C 5: 103,550,741 probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rasd2 A G 8: 75,221,974 N176S probably damaging Het
Rsbn1l A G 5: 20,919,787 V339A probably damaging Het
Ryr3 A G 2: 113,028,703 probably benign Het
Shkbp1 A G 7: 27,342,402 W676R probably benign Het
Sipa1 G A 19: 5,660,379 T201I probably benign Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Usp28 T C 9: 49,030,923 probably null Het
Zfp946 G T 17: 22,455,701 G479C probably benign Het
Other mutations in Gabra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Gabra4 APN 5 71633629 missense probably damaging 1.00
IGL01503:Gabra4 APN 5 71641086 missense possibly damaging 0.60
IGL02028:Gabra4 APN 5 71633596 missense probably damaging 1.00
IGL02688:Gabra4 APN 5 71572167 missense probably benign
IGL02749:Gabra4 APN 5 71638147 missense probably benign 0.42
IGL03095:Gabra4 APN 5 71624015 missense probably damaging 1.00
IGL03330:Gabra4 APN 5 71641064 missense probably null 1.00
E0354:Gabra4 UTSW 5 71640861 missense probably damaging 1.00
PIT4142001:Gabra4 UTSW 5 71571763 missense probably damaging 1.00
R1523:Gabra4 UTSW 5 71633632 missense probably damaging 1.00
R1622:Gabra4 UTSW 5 71571986 missense possibly damaging 0.57
R1689:Gabra4 UTSW 5 71633542 splice site probably null
R1930:Gabra4 UTSW 5 71638237 missense probably damaging 1.00
R1931:Gabra4 UTSW 5 71638237 missense probably damaging 1.00
R1967:Gabra4 UTSW 5 71572069 missense possibly damaging 0.87
R2095:Gabra4 UTSW 5 71624112 missense probably damaging 0.99
R2131:Gabra4 UTSW 5 71641224 missense probably benign 0.00
R2698:Gabra4 UTSW 5 71572078 missense probably benign 0.03
R3884:Gabra4 UTSW 5 71657257 missense probably benign 0.33
R4029:Gabra4 UTSW 5 71572189 missense probably benign 0.31
R4361:Gabra4 UTSW 5 71633545 critical splice donor site probably null
R4659:Gabra4 UTSW 5 71641144 missense probably damaging 1.00
R4682:Gabra4 UTSW 5 71657809 start codon destroyed probably null 0.74
R4810:Gabra4 UTSW 5 71623982 missense probably damaging 1.00
R4888:Gabra4 UTSW 5 71572203 missense probably benign 0.01
R5093:Gabra4 UTSW 5 71640864 missense probably damaging 1.00
R5121:Gabra4 UTSW 5 71572203 missense probably benign 0.01
R5889:Gabra4 UTSW 5 71571891 missense possibly damaging 0.61
R5906:Gabra4 UTSW 5 71623910 missense probably benign 0.00
R6574:Gabra4 UTSW 5 71623925 missense probably benign
R7068:Gabra4 UTSW 5 71572059 missense probably benign 0.07
R7571:Gabra4 UTSW 5 71571992 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGAAGGCCTGGTTGTGAAAC -3'
(R):5'- ACTGGAAAGTCAAAATGCATGC -3'

Sequencing Primer
(F):5'- AGACCTCTTTATGGAGAAAGATTCC -3'
(R):5'- GCAAAAACATGACATATCGTATCTG -3'
Posted On2015-04-17