Incidental Mutation 'R3924:Cdkl1'
ID307100
Institutional Source Beutler Lab
Gene Symbol Cdkl1
Ensembl Gene ENSMUSG00000020990
Gene Namecyclin-dependent kinase-like 1 (CDC2-related kinase)
Synonyms
MMRRC Submission 040915-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R3924 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69746848-69791267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69756599 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 168 (R168S)
Ref Sequence ENSEMBL: ENSMUSP00000021377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021377]
Predicted Effect probably damaging
Transcript: ENSMUST00000021377
AA Change: R168S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021377
Gene: ENSMUSG00000020990
AA Change: R168S

DomainStartEndE-ValueType
S_TKc 4 287 5.27e-105 SMART
Meta Mutation Damage Score 0.5500 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a large family of CDC2-related serine/threonine protein kinases. It accumulates primarily in the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik G T 9: 53,432,405 V119F probably benign Het
Agtpbp1 A T 13: 59,500,407 V533D probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Aldh3b3 A G 19: 3,968,491 N402S probably damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
Arpin A G 7: 79,929,687 Y63H probably benign Het
Brinp2 A G 1: 158,246,208 L781P probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Csad T C 15: 102,178,556 S427G probably benign Het
Dach1 A G 14: 97,915,903 V443A probably damaging Het
Dlat A G 9: 50,658,190 S160P possibly damaging Het
Dpf1 A G 7: 29,311,673 R165G possibly damaging Het
Dtd2 G C 12: 52,004,951 probably null Het
Fa2h A G 8: 111,393,515 Y80H probably damaging Het
Flii A G 11: 60,720,076 F509S probably damaging Het
Fmo9 A G 1: 166,664,652 S350P probably benign Het
Gabra4 A G 5: 71,642,253 probably benign Het
Gm3604 A G 13: 62,370,230 S105P probably damaging Het
Gpr155 T A 2: 73,370,076 L362F probably damaging Het
Lmbrd2 T C 15: 9,149,537 V86A probably benign Het
Lpcat4 G T 2: 112,246,716 Q468H possibly damaging Het
Luzp1 T C 4: 136,542,857 I797T probably damaging Het
Myh8 A T 11: 67,297,137 I912F probably damaging Het
Notch2 G T 3: 98,122,034 G1038* probably null Het
Nptx1 G T 11: 119,547,507 T28N possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Plekha5 A G 6: 140,570,379 N317S possibly damaging Het
Polr1a A G 6: 71,929,450 M417V probably benign Het
Ptpn13 T C 5: 103,550,741 probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rasd2 A G 8: 75,221,974 N176S probably damaging Het
Rsbn1l A G 5: 20,919,787 V339A probably damaging Het
Ryr3 A G 2: 113,028,703 probably benign Het
Shkbp1 A G 7: 27,342,402 W676R probably benign Het
Sipa1 G A 19: 5,660,379 T201I probably benign Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Usp28 T C 9: 49,030,923 probably null Het
Zfp946 G T 17: 22,455,701 G479C probably benign Het
Other mutations in Cdkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Cdkl1 APN 12 69750740 missense probably benign
IGL01859:Cdkl1 APN 12 69760129 missense probably damaging 1.00
R0218:Cdkl1 UTSW 12 69790035 missense probably benign 0.01
R0905:Cdkl1 UTSW 12 69756564 nonsense probably null
R3922:Cdkl1 UTSW 12 69756599 missense probably damaging 1.00
R3925:Cdkl1 UTSW 12 69756599 missense probably damaging 1.00
R5050:Cdkl1 UTSW 12 69757240 missense probably damaging 1.00
R5851:Cdkl1 UTSW 12 69756564 nonsense probably null
R7183:Cdkl1 UTSW 12 69748932 missense probably damaging 1.00
R7271:Cdkl1 UTSW 12 69748811 missense probably benign 0.10
R7461:Cdkl1 UTSW 12 69756461 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GTCAGCGGAAACCACTTACC -3'
(R):5'- AAAGCCTGCTAATCTCCTGC -3'

Sequencing Primer
(F):5'- GGAAACCACTTACCCAGGGTTTTC -3'
(R):5'- CTTGGCTATAGATTAACACCCAAGG -3'
Posted On2015-04-17