Incidental Mutation 'R3924:Lmbrd2'
ID307106
Institutional Source Beutler Lab
Gene Symbol Lmbrd2
Ensembl Gene ENSMUSG00000039704
Gene NameLMBR1 domain containing 2
Synonyms9930036E21Rik
MMRRC Submission 040915-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R3924 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location9140550-9202483 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9149537 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 86 (V86A)
Ref Sequence ENSEMBL: ENSMUSP00000154020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090380] [ENSMUST00000190131] [ENSMUST00000227556]
Predicted Effect probably benign
Transcript: ENSMUST00000090380
AA Change: V86A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087858
Gene: ENSMUSG00000039704
AA Change: V86A

DomainStartEndE-ValueType
Pfam:LMBR1 8 546 4.2e-192 PFAM
low complexity region 574 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190131
SMART Domains Protein: ENSMUSP00000139997
Gene: ENSMUSG00000054115

DomainStartEndE-ValueType
FBOX 65 105 2.3e-10 SMART
LRR 170 194 5.3e-1 SMART
LRR 195 219 5.3e-2 SMART
LRR 220 245 1.2e-1 SMART
LRR 299 324 1.2e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190406
Predicted Effect probably benign
Transcript: ENSMUST00000227556
AA Change: V86A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik G T 9: 53,432,405 V119F probably benign Het
Agtpbp1 A T 13: 59,500,407 V533D probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Aldh3b3 A G 19: 3,968,491 N402S probably damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
Arpin A G 7: 79,929,687 Y63H probably benign Het
Brinp2 A G 1: 158,246,208 L781P probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Csad T C 15: 102,178,556 S427G probably benign Het
Dach1 A G 14: 97,915,903 V443A probably damaging Het
Dlat A G 9: 50,658,190 S160P possibly damaging Het
Dpf1 A G 7: 29,311,673 R165G possibly damaging Het
Dtd2 G C 12: 52,004,951 probably null Het
Fa2h A G 8: 111,393,515 Y80H probably damaging Het
Flii A G 11: 60,720,076 F509S probably damaging Het
Fmo9 A G 1: 166,664,652 S350P probably benign Het
Gabra4 A G 5: 71,642,253 probably benign Het
Gm3604 A G 13: 62,370,230 S105P probably damaging Het
Gpr155 T A 2: 73,370,076 L362F probably damaging Het
Lpcat4 G T 2: 112,246,716 Q468H possibly damaging Het
Luzp1 T C 4: 136,542,857 I797T probably damaging Het
Myh8 A T 11: 67,297,137 I912F probably damaging Het
Notch2 G T 3: 98,122,034 G1038* probably null Het
Nptx1 G T 11: 119,547,507 T28N possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Plekha5 A G 6: 140,570,379 N317S possibly damaging Het
Polr1a A G 6: 71,929,450 M417V probably benign Het
Ptpn13 T C 5: 103,550,741 probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rasd2 A G 8: 75,221,974 N176S probably damaging Het
Rsbn1l A G 5: 20,919,787 V339A probably damaging Het
Ryr3 A G 2: 113,028,703 probably benign Het
Shkbp1 A G 7: 27,342,402 W676R probably benign Het
Sipa1 G A 19: 5,660,379 T201I probably benign Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Usp28 T C 9: 49,030,923 probably null Het
Zfp946 G T 17: 22,455,701 G479C probably benign Het
Other mutations in Lmbrd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Lmbrd2 APN 15 9157295 missense probably damaging 1.00
IGL00864:Lmbrd2 APN 15 9175210 missense probably damaging 1.00
IGL01554:Lmbrd2 APN 15 9165819 missense possibly damaging 0.96
IGL02142:Lmbrd2 APN 15 9186685 missense probably damaging 1.00
IGL02176:Lmbrd2 APN 15 9182574 missense probably damaging 1.00
IGL02293:Lmbrd2 APN 15 9172189 missense probably benign
IGL02692:Lmbrd2 APN 15 9149068 missense possibly damaging 0.94
IGL03101:Lmbrd2 APN 15 9186608 missense probably damaging 1.00
R0102:Lmbrd2 UTSW 15 9183952 missense probably damaging 1.00
R0370:Lmbrd2 UTSW 15 9165852 missense probably damaging 0.97
R0379:Lmbrd2 UTSW 15 9149479 missense probably benign 0.00
R0513:Lmbrd2 UTSW 15 9194729 missense probably damaging 1.00
R1610:Lmbrd2 UTSW 15 9186612 missense probably benign 0.19
R1628:Lmbrd2 UTSW 15 9182506 missense probably damaging 1.00
R1844:Lmbrd2 UTSW 15 9177751 nonsense probably null
R2422:Lmbrd2 UTSW 15 9194765 missense possibly damaging 0.83
R3614:Lmbrd2 UTSW 15 9177711 missense probably damaging 1.00
R4014:Lmbrd2 UTSW 15 9151585 splice site probably benign
R4298:Lmbrd2 UTSW 15 9165795 missense possibly damaging 0.92
R5126:Lmbrd2 UTSW 15 9194701 missense possibly damaging 0.91
R5699:Lmbrd2 UTSW 15 9175182 missense probably benign 0.40
R5841:Lmbrd2 UTSW 15 9182570 missense possibly damaging 0.94
R5974:Lmbrd2 UTSW 15 9172115 missense probably benign 0.25
R5988:Lmbrd2 UTSW 15 9182406 splice site probably null
R6179:Lmbrd2 UTSW 15 9149175 missense probably damaging 0.99
R6666:Lmbrd2 UTSW 15 9151569 missense probably benign 0.06
R7180:Lmbrd2 UTSW 15 9175196 missense possibly damaging 0.90
R7269:Lmbrd2 UTSW 15 9194684 missense probably damaging 1.00
R7341:Lmbrd2 UTSW 15 9165819 missense possibly damaging 0.96
R8017:Lmbrd2 UTSW 15 9172230 missense probably benign 0.00
R8066:Lmbrd2 UTSW 15 9172085 missense probably benign 0.35
R8110:Lmbrd2 UTSW 15 9175192 missense probably damaging 1.00
R8393:Lmbrd2 UTSW 15 9178350 missense probably damaging 1.00
R8401:Lmbrd2 UTSW 15 9156207 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTGGATGTCAGTACGGTAAGAG -3'
(R):5'- GGGCTGAAAGTTGAGAATGTCC -3'

Sequencing Primer
(F):5'- TCAGTACGGTAAGAGGCGGAAC -3'
(R):5'- CAAAAAGACAAACTGAGAGGAATAGG -3'
Posted On2015-04-17