Incidental Mutation 'R3924:Csad'
ID307107
Institutional Source Beutler Lab
Gene Symbol Csad
Ensembl Gene ENSMUSG00000023044
Gene Namecysteine sulfinic acid decarboxylase
Synonyms
MMRRC Submission 040915-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3924 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102176999-102204724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102178556 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 427 (S427G)
Ref Sequence ENSEMBL: ENSMUSP00000023805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023805] [ENSMUST00000230288] [ENSMUST00000230322] [ENSMUST00000230708] [ENSMUST00000231048]
Predicted Effect probably benign
Transcript: ENSMUST00000023805
AA Change: S427G

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000023805
Gene: ENSMUSG00000023044
AA Change: S427G

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 49 417 1.4e-113 PFAM
Pfam:Aminotran_5 120 281 4.9e-7 PFAM
low complexity region 482 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230253
Predicted Effect probably benign
Transcript: ENSMUST00000230288
Predicted Effect probably benign
Transcript: ENSMUST00000230322
Predicted Effect probably benign
Transcript: ENSMUST00000230342
Predicted Effect probably benign
Transcript: ENSMUST00000230708
Predicted Effect unknown
Transcript: ENSMUST00000231029
AA Change: S40G
Predicted Effect probably benign
Transcript: ENSMUST00000231048
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the group 2 decarboxylase family. A similar protein in rodents plays a role in multiple biological processes as the rate-limiting enzyme in taurine biosynthesis, catalyzing the decarboxylation of cysteinesulfinate to hypotaurine. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik G T 9: 53,432,405 V119F probably benign Het
Agtpbp1 A T 13: 59,500,407 V533D probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Aldh3b3 A G 19: 3,968,491 N402S probably damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
Arpin A G 7: 79,929,687 Y63H probably benign Het
Brinp2 A G 1: 158,246,208 L781P probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Dach1 A G 14: 97,915,903 V443A probably damaging Het
Dlat A G 9: 50,658,190 S160P possibly damaging Het
Dpf1 A G 7: 29,311,673 R165G possibly damaging Het
Dtd2 G C 12: 52,004,951 probably null Het
Fa2h A G 8: 111,393,515 Y80H probably damaging Het
Flii A G 11: 60,720,076 F509S probably damaging Het
Fmo9 A G 1: 166,664,652 S350P probably benign Het
Gabra4 A G 5: 71,642,253 probably benign Het
Gm3604 A G 13: 62,370,230 S105P probably damaging Het
Gpr155 T A 2: 73,370,076 L362F probably damaging Het
Lmbrd2 T C 15: 9,149,537 V86A probably benign Het
Lpcat4 G T 2: 112,246,716 Q468H possibly damaging Het
Luzp1 T C 4: 136,542,857 I797T probably damaging Het
Myh8 A T 11: 67,297,137 I912F probably damaging Het
Notch2 G T 3: 98,122,034 G1038* probably null Het
Nptx1 G T 11: 119,547,507 T28N possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Plekha5 A G 6: 140,570,379 N317S possibly damaging Het
Polr1a A G 6: 71,929,450 M417V probably benign Het
Ptpn13 T C 5: 103,550,741 probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rasd2 A G 8: 75,221,974 N176S probably damaging Het
Rsbn1l A G 5: 20,919,787 V339A probably damaging Het
Ryr3 A G 2: 113,028,703 probably benign Het
Shkbp1 A G 7: 27,342,402 W676R probably benign Het
Sipa1 G A 19: 5,660,379 T201I probably benign Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Usp28 T C 9: 49,030,923 probably null Het
Zfp946 G T 17: 22,455,701 G479C probably benign Het
Other mutations in Csad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Csad APN 15 102187163 missense probably damaging 1.00
IGL01769:Csad APN 15 102180081 missense probably benign 0.02
IGL02254:Csad APN 15 102186437 nonsense probably null
dejavu UTSW 15 102179972 missense probably damaging 1.00
dell UTSW 15 102178606 missense probably damaging 1.00
lenovo UTSW 15 102179034 missense probably null 1.00
PIT4382001:Csad UTSW 15 102188650 missense probably benign 0.00
R0701:Csad UTSW 15 102179136 missense probably benign 0.42
R1595:Csad UTSW 15 102177782 missense probably damaging 1.00
R1707:Csad UTSW 15 102179972 missense probably damaging 1.00
R2107:Csad UTSW 15 102179034 missense probably null 1.00
R2196:Csad UTSW 15 102187593 missense probably benign 0.00
R2275:Csad UTSW 15 102187122 missense probably damaging 0.98
R2504:Csad UTSW 15 102188667 start codon destroyed probably null 0.97
R2928:Csad UTSW 15 102177704 missense probably damaging 1.00
R6235:Csad UTSW 15 102178606 missense probably damaging 1.00
R6418:Csad UTSW 15 102179523 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGGTGACTTCCTCTGGTAACC -3'
(R):5'- TGTTCCAGACATGAAGCCTC -3'

Sequencing Primer
(F):5'- AGAAATATATTTTTCTCCCTACCTGC -3'
(R):5'- TGTTCCAGACATGAAGCCTCATAAAG -3'
Posted On2015-04-17