Incidental Mutation 'R3924:Onecut2'
ID307109
Institutional Source Beutler Lab
Gene Symbol Onecut2
Ensembl Gene ENSMUSG00000045991
Gene Nameone cut domain, family member 2
SynonymsOc2, OC-2
MMRRC Submission 040915-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.733) question?
Stock #R3924 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location64340364-64398488 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64341520 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 381 (K381E)
Ref Sequence ENSEMBL: ENSMUSP00000110798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115145] [ENSMUST00000175965]
Predicted Effect probably damaging
Transcript: ENSMUST00000115145
AA Change: K381E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110798
Gene: ENSMUSG00000045991
AA Change: K381E

DomainStartEndE-ValueType
low complexity region 34 56 N/A INTRINSIC
low complexity region 92 111 N/A INTRINSIC
low complexity region 146 158 N/A INTRINSIC
low complexity region 167 185 N/A INTRINSIC
low complexity region 311 323 N/A INTRINSIC
CUT 326 411 1e-42 SMART
HOX 427 489 2.63e-12 SMART
low complexity region 491 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175965
AA Change: K362E

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135692
Gene: ENSMUSG00000045991
AA Change: K362E

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
low complexity region 73 92 N/A INTRINSIC
low complexity region 127 139 N/A INTRINSIC
low complexity region 148 166 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
CUT 307 392 1e-42 SMART
HOX 408 470 2.63e-12 SMART
low complexity region 472 482 N/A INTRINSIC
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the onecut family of transcription factors, which are characterized by a cut domain and an atypical homeodomain. The protein binds to specific DNA sequences and stimulates expression of target genes, including genes involved in melanocyte and hepatocyte differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in abnormal bile duct development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik G T 9: 53,432,405 V119F probably benign Het
Agtpbp1 A T 13: 59,500,407 V533D probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Aldh3b3 A G 19: 3,968,491 N402S probably damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
Arpin A G 7: 79,929,687 Y63H probably benign Het
Brinp2 A G 1: 158,246,208 L781P probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Csad T C 15: 102,178,556 S427G probably benign Het
Dach1 A G 14: 97,915,903 V443A probably damaging Het
Dlat A G 9: 50,658,190 S160P possibly damaging Het
Dpf1 A G 7: 29,311,673 R165G possibly damaging Het
Dtd2 G C 12: 52,004,951 probably null Het
Fa2h A G 8: 111,393,515 Y80H probably damaging Het
Flii A G 11: 60,720,076 F509S probably damaging Het
Fmo9 A G 1: 166,664,652 S350P probably benign Het
Gabra4 A G 5: 71,642,253 probably benign Het
Gm3604 A G 13: 62,370,230 S105P probably damaging Het
Gpr155 T A 2: 73,370,076 L362F probably damaging Het
Lmbrd2 T C 15: 9,149,537 V86A probably benign Het
Lpcat4 G T 2: 112,246,716 Q468H possibly damaging Het
Luzp1 T C 4: 136,542,857 I797T probably damaging Het
Myh8 A T 11: 67,297,137 I912F probably damaging Het
Notch2 G T 3: 98,122,034 G1038* probably null Het
Nptx1 G T 11: 119,547,507 T28N possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Plekha5 A G 6: 140,570,379 N317S possibly damaging Het
Polr1a A G 6: 71,929,450 M417V probably benign Het
Ptpn13 T C 5: 103,550,741 probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rasd2 A G 8: 75,221,974 N176S probably damaging Het
Rsbn1l A G 5: 20,919,787 V339A probably damaging Het
Ryr3 A G 2: 113,028,703 probably benign Het
Shkbp1 A G 7: 27,342,402 W676R probably benign Het
Sipa1 G A 19: 5,660,379 T201I probably benign Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Usp28 T C 9: 49,030,923 probably null Het
Zfp946 G T 17: 22,455,701 G479C probably benign Het
Other mutations in Onecut2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Onecut2 APN 18 64341089 missense probably damaging 1.00
IGL01712:Onecut2 APN 18 64386602 missense probably damaging 0.97
IGL01925:Onecut2 APN 18 64341514 missense probably damaging 1.00
IGL03105:Onecut2 APN 18 64341508 nonsense probably null
R0197:Onecut2 UTSW 18 64341472 missense possibly damaging 0.91
R0504:Onecut2 UTSW 18 64340749 missense possibly damaging 0.72
R1514:Onecut2 UTSW 18 64341580 missense possibly damaging 0.93
R2314:Onecut2 UTSW 18 64341197 missense probably damaging 0.99
R3923:Onecut2 UTSW 18 64341520 missense probably damaging 0.98
R3925:Onecut2 UTSW 18 64341520 missense probably damaging 0.98
R4888:Onecut2 UTSW 18 64340927 missense possibly damaging 0.86
R5818:Onecut2 UTSW 18 64340975 missense possibly damaging 0.76
R5995:Onecut2 UTSW 18 64341548 missense probably damaging 0.99
R7132:Onecut2 UTSW 18 64340912 missense possibly damaging 0.79
R7232:Onecut2 UTSW 18 64341562 missense probably damaging 1.00
R7250:Onecut2 UTSW 18 64386440 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AATGGCTTACACCACCCTGG -3'
(R):5'- ACTGGCAATGAAAACTCAGAGTC -3'

Sequencing Primer
(F):5'- CTCCTCGGGTTCTCAGGTG -3'
(R):5'- AACTCAGAGTCAAGGAGTGTG -3'
Posted On2015-04-17