Incidental Mutation 'R3935:Kyat1'
ID307118
Institutional Source Beutler Lab
Gene Symbol Kyat1
Ensembl Gene ENSMUSG00000039648
Gene Namekynurenine aminotransferase 1
SynonymsKat1, 2010009K05Rik, Ccbl1, KATI, cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #R3935 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location30185124-30205847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30185749 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 376 (L376P)
Ref Sequence ENSEMBL: ENSMUSP00000109293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044038] [ENSMUST00000113659] [ENSMUST00000113660] [ENSMUST00000113661] [ENSMUST00000113662] [ENSMUST00000113663]
Predicted Effect probably damaging
Transcript: ENSMUST00000044038
AA Change: L376P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038612
Gene: ENSMUSG00000039648
AA Change: L376P

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 415 1.1e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113659
AA Change: L326P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109289
Gene: ENSMUSG00000039648
AA Change: L326P

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 53 365 1.5e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113660
AA Change: L333P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109290
Gene: ENSMUSG00000039648
AA Change: L333P

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 145 1.7e-12 PFAM
Pfam:Aminotran_1_2 146 372 1e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113661
AA Change: L376P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109291
Gene: ENSMUSG00000039648
AA Change: L376P

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 415 1.1e-56 PFAM
Pfam:DegT_DnrJ_EryC1 80 214 3.7e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113662
AA Change: L376P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109292
Gene: ENSMUSG00000039648
AA Change: L376P

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 415 1.1e-56 PFAM
Pfam:DegT_DnrJ_EryC1 80 214 3.7e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113663
AA Change: L376P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109293
Gene: ENSMUSG00000039648
AA Change: L376P

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 415 1.1e-56 PFAM
Pfam:DegT_DnrJ_EryC1 80 214 3.7e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148555
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme that is responsible for the metabolism of cysteine conjugates of certain halogenated alkenes and alkanes. This metabolism can form reactive metabolites leading to nephrotoxicity and neurotoxicity. Increased levels of this enzyme have been linked to schizophrenia. Multiple transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arx T A X: 93,297,369 L554Q probably damaging Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Bbof1 A G 12: 84,411,210 D83G probably damaging Het
Ccdc47 T C 11: 106,201,997 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Dsc1 T A 18: 20,097,241 T336S probably benign Het
Elk3 A G 10: 93,265,173 S239P possibly damaging Het
Fbll1 T A 11: 35,797,648 I263F probably damaging Het
Fbxw8 T G 5: 118,095,718 I283L probably benign Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Gpr176 A G 2: 118,279,296 V494A probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hoxd11 A G 2: 74,684,032 N302S probably benign Het
Iqgap1 T G 7: 80,743,837 Y664S possibly damaging Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Kif1b T C 4: 149,237,160 N1101D probably benign Het
Lztr1 T A 16: 17,522,195 Y93* probably null Het
Nrip1 A G 16: 76,294,435 M78T possibly damaging Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Prg4 A G 1: 150,458,157 I152T possibly damaging Het
Prss36 A G 7: 127,934,608 L8P probably damaging Het
Prune2 T C 19: 17,199,786 V2930A probably damaging Het
Ptchd4 G C 17: 42,503,489 L760F possibly damaging Het
Rbms3 A G 9: 116,636,391 L163P probably damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Sirpb1b T A 3: 15,548,783 T80S probably benign Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slmap T C 14: 26,459,415 E411G probably benign Het
Ssu72 C T 4: 155,705,419 S13L probably benign Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tmem80 T C 7: 141,334,025 Y30H probably damaging Het
Other mutations in Kyat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Kyat1 APN 2 30185553 missense probably benign 0.00
IGL02216:Kyat1 APN 2 30187252 missense probably benign 0.44
IGL02864:Kyat1 APN 2 30192077 splice site probably benign
IGL02975:Kyat1 APN 2 30186675 missense probably damaging 0.99
R0193:Kyat1 UTSW 2 30187186 critical splice donor site probably null
R0230:Kyat1 UTSW 2 30194075 missense probably benign
R0539:Kyat1 UTSW 2 30188217 missense probably damaging 1.00
R2483:Kyat1 UTSW 2 30186698 missense possibly damaging 0.71
R4651:Kyat1 UTSW 2 30194064 missense probably benign 0.00
R4685:Kyat1 UTSW 2 30188265 missense probably damaging 1.00
R5031:Kyat1 UTSW 2 30188090 missense probably damaging 1.00
R5699:Kyat1 UTSW 2 30186650 missense probably benign 0.01
R5722:Kyat1 UTSW 2 30188111 missense probably damaging 1.00
R7299:Kyat1 UTSW 2 30191995 missense probably benign 0.02
R8000:Kyat1 UTSW 2 30192053 missense probably benign
R8231:Kyat1 UTSW 2 30191966 missense probably benign 0.00
R8687:Kyat1 UTSW 2 30185747 missense probably benign 0.20
Z1176:Kyat1 UTSW 2 30187732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCACAGCCTCTTATCCATGG -3'
(R):5'- ATGCTGCAGAGTCTGTTGTC -3'

Sequencing Primer
(F):5'- TTGTCCTGCAAGATACACACTGAG -3'
(R):5'- GCAGAGTCTGTTGTCTGCACC -3'
Posted On2015-04-17