Incidental Mutation 'R3935:Hoxd11'
ID307121
Institutional Source Beutler Lab
Gene Symbol Hoxd11
Ensembl Gene ENSMUSG00000042499
Gene Namehomeobox D11
SynonymsHox-5.4, Hox-4.6, E230017H14Rik, Hox-5.5
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.761) question?
Stock #R3935 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location74679557-74687016 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74684032 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 302 (N302S)
Ref Sequence ENSEMBL: ENSMUSP00000122582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000142312]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136302
Predicted Effect probably benign
Transcript: ENSMUST00000142312
AA Change: N302S

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122582
Gene: ENSMUSG00000042499
AA Change: N302S

DomainStartEndE-ValueType
Pfam:DUF3528 26 80 5.4e-25 PFAM
Pfam:DUF3528 103 198 7.1e-21 PFAM
low complexity region 224 257 N/A INTRINSIC
HOX 264 326 1.58e-24 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. The product of the mouse Hoxd11 gene plays a role in forelimb morphogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit homeotic transformations of sacral vertebrae, malformations of distal limbs, and reduced fertility in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arx T A X: 93,297,369 L554Q probably damaging Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Bbof1 A G 12: 84,411,210 D83G probably damaging Het
Ccdc47 T C 11: 106,201,997 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Dsc1 T A 18: 20,097,241 T336S probably benign Het
Elk3 A G 10: 93,265,173 S239P possibly damaging Het
Fbll1 T A 11: 35,797,648 I263F probably damaging Het
Fbxw8 T G 5: 118,095,718 I283L probably benign Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Gpr176 A G 2: 118,279,296 V494A probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Iqgap1 T G 7: 80,743,837 Y664S possibly damaging Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Kif1b T C 4: 149,237,160 N1101D probably benign Het
Kyat1 A G 2: 30,185,749 L376P probably damaging Het
Lztr1 T A 16: 17,522,195 Y93* probably null Het
Nrip1 A G 16: 76,294,435 M78T possibly damaging Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Prg4 A G 1: 150,458,157 I152T possibly damaging Het
Prss36 A G 7: 127,934,608 L8P probably damaging Het
Prune2 T C 19: 17,199,786 V2930A probably damaging Het
Ptchd4 G C 17: 42,503,489 L760F possibly damaging Het
Rbms3 A G 9: 116,636,391 L163P probably damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Sirpb1b T A 3: 15,548,783 T80S probably benign Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slmap T C 14: 26,459,415 E411G probably benign Het
Ssu72 C T 4: 155,705,419 S13L probably benign Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tmem80 T C 7: 141,334,025 Y30H probably damaging Het
Other mutations in Hoxd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00550:Hoxd11 APN 2 74684041 missense probably damaging 1.00
R1202:Hoxd11 UTSW 2 74682577 missense possibly damaging 0.92
R3895:Hoxd11 UTSW 2 74682792 missense probably damaging 0.99
R5386:Hoxd11 UTSW 2 74682819 nonsense probably null
R7322:Hoxd11 UTSW 2 74684011 missense probably damaging 1.00
R7476:Hoxd11 UTSW 2 74684115 missense probably damaging 0.96
R8060:Hoxd11 UTSW 2 74682376 start gained probably benign
R8188:Hoxd11 UTSW 2 74683954 missense probably damaging 1.00
R8315:Hoxd11 UTSW 2 74683122 missense probably benign 0.00
R8697:Hoxd11 UTSW 2 74682669 missense unknown
R8875:Hoxd11 UTSW 2 74683021 missense probably benign 0.00
Z1177:Hoxd11 UTSW 2 74682415 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAGTAGCCTCTCTCACC -3'
(R):5'- CGAGAAGAAATCGTGAAGTTCC -3'

Sequencing Primer
(F):5'- AGTAGCCTCTCTCACCTCTTGG -3'
(R):5'- ACATTGGGCCTGCTGAGAG -3'
Posted On2015-04-17