Incidental Mutation 'R3935:Gpr176'
ID307122
Institutional Source Beutler Lab
Gene Symbol Gpr176
Ensembl Gene ENSMUSG00000040133
Gene NameG protein-coupled receptor 176
SynonymsLOC381413
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3935 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118277110-118373419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118279296 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 494 (V494A)
Ref Sequence ENSEMBL: ENSMUSP00000037586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039160]
Predicted Effect probably benign
Transcript: ENSMUST00000039160
AA Change: V494A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037586
Gene: ENSMUSG00000040133
AA Change: V494A

DomainStartEndE-ValueType
Pfam:7tm_1 57 319 1.5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189100
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the G protein-coupled receptor family, such as GPR176, are cell surface receptors involved in responses to hormones, growth factors, and neurotransmitters (Hata et al., 1995 [PubMed 7893747]).[supplied by OMIM, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arx T A X: 93,297,369 L554Q probably damaging Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Bbof1 A G 12: 84,411,210 D83G probably damaging Het
Ccdc47 T C 11: 106,201,997 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Dsc1 T A 18: 20,097,241 T336S probably benign Het
Elk3 A G 10: 93,265,173 S239P possibly damaging Het
Fbll1 T A 11: 35,797,648 I263F probably damaging Het
Fbxw8 T G 5: 118,095,718 I283L probably benign Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hoxd11 A G 2: 74,684,032 N302S probably benign Het
Iqgap1 T G 7: 80,743,837 Y664S possibly damaging Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Kif1b T C 4: 149,237,160 N1101D probably benign Het
Kyat1 A G 2: 30,185,749 L376P probably damaging Het
Lztr1 T A 16: 17,522,195 Y93* probably null Het
Nrip1 A G 16: 76,294,435 M78T possibly damaging Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Prg4 A G 1: 150,458,157 I152T possibly damaging Het
Prss36 A G 7: 127,934,608 L8P probably damaging Het
Prune2 T C 19: 17,199,786 V2930A probably damaging Het
Ptchd4 G C 17: 42,503,489 L760F possibly damaging Het
Rbms3 A G 9: 116,636,391 L163P probably damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Sirpb1b T A 3: 15,548,783 T80S probably benign Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slmap T C 14: 26,459,415 E411G probably benign Het
Ssu72 C T 4: 155,705,419 S13L probably benign Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tmem80 T C 7: 141,334,025 Y30H probably damaging Het
Other mutations in Gpr176
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01969:Gpr176 APN 2 118279637 missense probably damaging 0.99
R0334:Gpr176 UTSW 2 118279708 missense probably benign
R0483:Gpr176 UTSW 2 118279723 missense probably damaging 0.99
R0522:Gpr176 UTSW 2 118284012 missense probably damaging 1.00
R0784:Gpr176 UTSW 2 118373052 missense possibly damaging 0.57
R1565:Gpr176 UTSW 2 118280214 missense probably benign
R1860:Gpr176 UTSW 2 118373178 missense probably damaging 1.00
R2029:Gpr176 UTSW 2 118279432 missense probably benign 0.02
R2311:Gpr176 UTSW 2 118279446 missense probably benign
R4241:Gpr176 UTSW 2 118279610 missense probably benign 0.22
R5112:Gpr176 UTSW 2 118280148 missense possibly damaging 0.88
R5927:Gpr176 UTSW 2 118373040 missense probably benign 0.03
R5996:Gpr176 UTSW 2 118283904 critical splice donor site probably null
R8172:Gpr176 UTSW 2 118284134 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGACTTCCCTTTCACTCAGAAGC -3'
(R):5'- ACAGTGGACTCTGAACCTCG -3'

Sequencing Primer
(F):5'- CATCTGCCCCATAGAGGAGTTGTC -3'
(R):5'- ACTCTGAACCTCGGGTGTC -3'
Posted On2015-04-17