Incidental Mutation 'R3935:Sirpb1b'
ID 307123
Institutional Source Beutler Lab
Gene Symbol Sirpb1b
Ensembl Gene ENSMUSG00000095028
Gene Name signal-regulatory protein beta 1B
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R3935 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 15560814-15640127 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 15613843 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 80 (T80S)
Ref Sequence ENSEMBL: ENSMUSP00000088869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091319] [ENSMUST00000192382] [ENSMUST00000195778]
AlphaFold A0A0A6YXN8
Predicted Effect probably benign
Transcript: ENSMUST00000091319
AA Change: T80S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000088869
Gene: ENSMUSG00000095028
AA Change: T80S

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
IG 37 143 8.19e-9 SMART
IGc1 163 236 1.22e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192382
AA Change: T80S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000142068
Gene: ENSMUSG00000095028
AA Change: T80S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG 37 143 3.3e-11 SMART
IGc1 163 236 5.1e-7 SMART
Pfam:C2-set_2 251 340 1e-4 PFAM
Pfam:Ig_2 251 348 2.7e-1 PFAM
Pfam:C1-set 258 341 1.3e-13 PFAM
transmembrane domain 370 392 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194767
Predicted Effect probably benign
Transcript: ENSMUST00000195778
SMART Domains Protein: ENSMUSP00000141533
Gene: ENSMUSG00000095028

DomainStartEndE-ValueType
Pfam:Ig_2 14 66 5.6e-1 PFAM
Pfam:Ig_3 22 52 7.8e-3 PFAM
Pfam:V-set 24 75 1.9e-7 PFAM
IGc1 96 169 5.1e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arx T A X: 92,340,975 (GRCm39) L554Q probably damaging Het
Baz2b A G 2: 59,743,105 (GRCm39) V1622A possibly damaging Het
Bbof1 A G 12: 84,457,984 (GRCm39) D83G probably damaging Het
Ccdc47 T C 11: 106,092,823 (GRCm39) probably benign Het
Clstn3 G A 6: 124,434,901 (GRCm39) T338I probably damaging Het
Dsc1 T A 18: 20,230,298 (GRCm39) T336S probably benign Het
Elk3 A G 10: 93,101,035 (GRCm39) S239P possibly damaging Het
Fbll1 T A 11: 35,688,475 (GRCm39) I263F probably damaging Het
Fbxw8 T G 5: 118,233,783 (GRCm39) I283L probably benign Het
Fcgbp T C 7: 27,774,824 (GRCm39) F133L probably benign Het
Gpr176 A G 2: 118,109,777 (GRCm39) V494A probably benign Het
Gpr85 A G 6: 13,836,044 (GRCm39) F287L probably benign Het
Hoxd11 A G 2: 74,514,376 (GRCm39) N302S probably benign Het
Iqgap1 T G 7: 80,393,585 (GRCm39) Y664S possibly damaging Het
Kansl1 A T 11: 104,234,369 (GRCm39) D712E possibly damaging Het
Kif1b T C 4: 149,321,617 (GRCm39) N1101D probably benign Het
Kyat1 A G 2: 30,075,761 (GRCm39) L376P probably damaging Het
Lztr1 T A 16: 17,340,059 (GRCm39) Y93* probably null Het
Nrip1 A G 16: 76,091,323 (GRCm39) M78T possibly damaging Het
P4hb A C 11: 120,453,235 (GRCm39) H440Q probably benign Het
Pbsn T C X: 76,891,702 (GRCm39) T32A probably damaging Het
Prg4 A G 1: 150,333,908 (GRCm39) I152T possibly damaging Het
Prss36 A G 7: 127,533,780 (GRCm39) L8P probably damaging Het
Prune2 T C 19: 17,177,150 (GRCm39) V2930A probably damaging Het
Ptchd4 G C 17: 42,814,380 (GRCm39) L760F possibly damaging Het
Rbms3 A G 9: 116,465,459 (GRCm39) L163P probably damaging Het
Scn1a T C 2: 66,158,120 (GRCm39) I418V probably damaging Het
Sf3a1 T A 11: 4,130,024 (GRCm39) probably null Het
Slc16a7 C A 10: 125,066,712 (GRCm39) R309L probably damaging Het
Slc35f1 C T 10: 52,984,314 (GRCm39) T358I probably damaging Het
Slmap T C 14: 26,180,570 (GRCm39) E411G probably benign Het
Ssu72 C T 4: 155,789,876 (GRCm39) S13L probably benign Het
Sult2b1 C T 7: 45,391,640 (GRCm39) V49M probably benign Het
Tmem80 T C 7: 140,913,938 (GRCm39) Y30H probably damaging Het
Other mutations in Sirpb1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Sirpb1b APN 3 15,613,789 (GRCm39) missense probably damaging 0.99
IGL01662:Sirpb1b APN 3 15,608,244 (GRCm39) missense probably damaging 1.00
IGL02025:Sirpb1b APN 3 15,613,863 (GRCm39) missense probably damaging 0.99
F5770:Sirpb1b UTSW 3 15,568,243 (GRCm39) missense probably benign 0.25
R0419:Sirpb1b UTSW 3 15,613,656 (GRCm39) missense probably damaging 1.00
R1538:Sirpb1b UTSW 3 15,613,819 (GRCm39) missense possibly damaging 0.81
R4300:Sirpb1b UTSW 3 15,613,821 (GRCm39) missense probably damaging 1.00
R4373:Sirpb1b UTSW 3 15,613,821 (GRCm39) missense probably damaging 1.00
R4953:Sirpb1b UTSW 3 15,613,887 (GRCm39) missense probably damaging 1.00
R5425:Sirpb1b UTSW 3 15,613,729 (GRCm39) missense probably damaging 1.00
R6340:Sirpb1b UTSW 3 15,613,725 (GRCm39) missense probably damaging 1.00
R6357:Sirpb1b UTSW 3 15,568,243 (GRCm39) missense possibly damaging 0.79
R6723:Sirpb1b UTSW 3 15,613,858 (GRCm39) missense possibly damaging 0.78
R7152:Sirpb1b UTSW 3 15,607,230 (GRCm39) missense probably benign 0.25
R7390:Sirpb1b UTSW 3 15,608,100 (GRCm39) nonsense probably null
R7411:Sirpb1b UTSW 3 15,608,057 (GRCm39) missense probably benign 0.22
R7513:Sirpb1b UTSW 3 15,607,200 (GRCm39) nonsense probably null
R7526:Sirpb1b UTSW 3 15,613,932 (GRCm39) missense probably damaging 1.00
R8352:Sirpb1b UTSW 3 15,607,410 (GRCm39) missense probably benign 0.03
R8452:Sirpb1b UTSW 3 15,607,410 (GRCm39) missense probably benign 0.03
R8794:Sirpb1b UTSW 3 15,613,843 (GRCm39) missense probably benign 0.05
R9165:Sirpb1b UTSW 3 15,639,964 (GRCm39) missense probably damaging 1.00
R9793:Sirpb1b UTSW 3 15,640,074 (GRCm39) unclassified probably benign
V7583:Sirpb1b UTSW 3 15,568,243 (GRCm39) missense probably benign 0.25
Z1177:Sirpb1b UTSW 3 15,640,001 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGACAACTCAGTGCCACCTC -3'
(R):5'- AAACTTGAGAAACCTGTGGTTC -3'

Sequencing Primer
(F):5'- TCAGTGCCACCTCCAGACTG -3'
(R):5'- CTTGAGAAACCTGTGGTTCTACATC -3'
Posted On 2015-04-17