Incidental Mutation 'R3935:Clstn3'
ID307128
Institutional Source Beutler Lab
Gene Symbol Clstn3
Ensembl Gene ENSMUSG00000008153
Gene Namecalsyntenin 3
Synonymsalcadein-beta, Cst-3, CSTN3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3935 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124430759-124464794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 124457942 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 338 (T338I)
Ref Sequence ENSEMBL: ENSMUSP00000108142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523] [ENSMUST00000150774]
Predicted Effect probably damaging
Transcript: ENSMUST00000008297
AA Change: T375I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153
AA Change: T375I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CA 50 143 2.72e-12 SMART
CA 166 244 4.04e-2 SMART
SCOP:d1a8d_1 333 549 7e-23 SMART
transmembrane domain 846 868 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112523
AA Change: T338I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153
AA Change: T338I

DomainStartEndE-ValueType
CA 13 106 2.72e-12 SMART
CA 129 207 4.04e-2 SMART
Pfam:Laminin_G_3 304 505 4.1e-8 PFAM
transmembrane domain 809 831 N/A INTRINSIC
low complexity region 891 908 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150774
SMART Domains Protein: ENSMUSP00000145422
Gene: ENSMUSG00000008153

DomainStartEndE-ValueType
Blast:CA 13 64 4e-31 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156040
Meta Mutation Damage Score 0.3507 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arx T A X: 93,297,369 L554Q probably damaging Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Bbof1 A G 12: 84,411,210 D83G probably damaging Het
Ccdc47 T C 11: 106,201,997 probably benign Het
Dsc1 T A 18: 20,097,241 T336S probably benign Het
Elk3 A G 10: 93,265,173 S239P possibly damaging Het
Fbll1 T A 11: 35,797,648 I263F probably damaging Het
Fbxw8 T G 5: 118,095,718 I283L probably benign Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Gpr176 A G 2: 118,279,296 V494A probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hoxd11 A G 2: 74,684,032 N302S probably benign Het
Iqgap1 T G 7: 80,743,837 Y664S possibly damaging Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Kif1b T C 4: 149,237,160 N1101D probably benign Het
Kyat1 A G 2: 30,185,749 L376P probably damaging Het
Lztr1 T A 16: 17,522,195 Y93* probably null Het
Nrip1 A G 16: 76,294,435 M78T possibly damaging Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Prg4 A G 1: 150,458,157 I152T possibly damaging Het
Prss36 A G 7: 127,934,608 L8P probably damaging Het
Prune2 T C 19: 17,199,786 V2930A probably damaging Het
Ptchd4 G C 17: 42,503,489 L760F possibly damaging Het
Rbms3 A G 9: 116,636,391 L163P probably damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Sirpb1b T A 3: 15,548,783 T80S probably benign Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slmap T C 14: 26,459,415 E411G probably benign Het
Ssu72 C T 4: 155,705,419 S13L probably benign Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tmem80 T C 7: 141,334,025 Y30H probably damaging Het
Other mutations in Clstn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Clstn3 APN 6 124462139 missense probably damaging 1.00
IGL01415:Clstn3 APN 6 124438822 nonsense probably null
IGL01521:Clstn3 APN 6 124458031 nonsense probably null
IGL01537:Clstn3 APN 6 124431600 missense possibly damaging 0.91
IGL01729:Clstn3 APN 6 124449794 missense probably benign 0.06
IGL01879:Clstn3 APN 6 124438810 missense probably damaging 1.00
IGL01998:Clstn3 APN 6 124458663 missense probably damaging 1.00
IGL03130:Clstn3 APN 6 124459263 missense probably damaging 0.98
IGL03405:Clstn3 APN 6 124438368 missense possibly damaging 0.95
PIT4403001:Clstn3 UTSW 6 124458023 missense probably damaging 1.00
R0049:Clstn3 UTSW 6 124459853 missense possibly damaging 0.87
R0049:Clstn3 UTSW 6 124459853 missense possibly damaging 0.87
R0208:Clstn3 UTSW 6 124432169 splice site probably benign
R0276:Clstn3 UTSW 6 124431740 splice site probably benign
R0440:Clstn3 UTSW 6 124451413 missense probably damaging 1.00
R0612:Clstn3 UTSW 6 124449500 missense probably damaging 0.98
R1200:Clstn3 UTSW 6 124459170 missense probably damaging 1.00
R1224:Clstn3 UTSW 6 124457919 missense probably benign
R1378:Clstn3 UTSW 6 124438419 missense probably damaging 1.00
R1491:Clstn3 UTSW 6 124437490 missense possibly damaging 0.51
R1495:Clstn3 UTSW 6 124449917 missense probably benign 0.00
R1511:Clstn3 UTSW 6 124462169 missense probably damaging 1.00
R1655:Clstn3 UTSW 6 124437427 missense probably damaging 1.00
R1731:Clstn3 UTSW 6 124431632 missense probably benign 0.04
R1734:Clstn3 UTSW 6 124436814 splice site probably benign
R1751:Clstn3 UTSW 6 124431999 missense probably damaging 1.00
R1954:Clstn3 UTSW 6 124459298 missense possibly damaging 0.94
R2133:Clstn3 UTSW 6 124449503 missense probably benign
R2192:Clstn3 UTSW 6 124459207 missense probably damaging 1.00
R2314:Clstn3 UTSW 6 124450717 missense probably benign 0.39
R2874:Clstn3 UTSW 6 124438335 missense probably damaging 1.00
R3500:Clstn3 UTSW 6 124431711 missense probably benign 0.01
R3761:Clstn3 UTSW 6 124457876 missense possibly damaging 0.54
R3878:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R3927:Clstn3 UTSW 6 124451368 missense probably damaging 1.00
R3934:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R4063:Clstn3 UTSW 6 124449833 missense possibly damaging 0.51
R4402:Clstn3 UTSW 6 124456980 missense probably damaging 0.96
R4534:Clstn3 UTSW 6 124459220 missense probably damaging 1.00
R4785:Clstn3 UTSW 6 124437372 splice site probably null
R4834:Clstn3 UTSW 6 124431953 splice site probably null
R5921:Clstn3 UTSW 6 124431580 utr 3 prime probably benign
R5932:Clstn3 UTSW 6 124438332 missense probably benign 0.01
R6025:Clstn3 UTSW 6 124431664 missense possibly damaging 0.73
R6101:Clstn3 UTSW 6 124461670 missense probably damaging 1.00
R6360:Clstn3 UTSW 6 124438429 missense possibly damaging 0.88
R6578:Clstn3 UTSW 6 124450704 critical splice donor site probably null
R6813:Clstn3 UTSW 6 124436935 missense probably benign 0.00
R7380:Clstn3 UTSW 6 124456989 missense probably benign 0.01
R7419:Clstn3 UTSW 6 124458129 missense probably benign 0.05
R7625:Clstn3 UTSW 6 124437418 nonsense probably null
R7780:Clstn3 UTSW 6 124462202 missense probably damaging 0.98
R7936:Clstn3 UTSW 6 124432013 missense possibly damaging 0.73
R7939:Clstn3 UTSW 6 124462199 missense probably damaging 1.00
R8047:Clstn3 UTSW 6 124432013 missense possibly damaging 0.73
R8079:Clstn3 UTSW 6 124459804 missense probably damaging 1.00
R8085:Clstn3 UTSW 6 124458724 missense probably benign 0.23
R8299:Clstn3 UTSW 6 124437373 critical splice donor site probably null
R8406:Clstn3 UTSW 6 124462177 missense probably damaging 1.00
RF014:Clstn3 UTSW 6 124459266 nonsense probably null
X0066:Clstn3 UTSW 6 124449811 missense probably benign 0.13
Z1176:Clstn3 UTSW 6 124459200 missense probably damaging 1.00
Z1177:Clstn3 UTSW 6 124449781 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTGCCAACAGTACTTATTGG -3'
(R):5'- AGAGGAGATGAATTGTTTCCTTTCC -3'

Sequencing Primer
(F):5'- CCAACAGTACTTATTGGGTAACGGC -3'
(R):5'- CCTTTGGGGCATCTGCAG -3'
Posted On2015-04-17