Incidental Mutation 'R0375:Marf1'
ID 30713
Institutional Source Beutler Lab
Gene Symbol Marf1
Ensembl Gene ENSMUSG00000060657
Gene Name meiosis regulator and mRNA stability 1
Synonyms 4921513D23Rik
MMRRC Submission 038581-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.222) question?
Stock # R0375 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 13927030-13977157 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 13969184 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090300] [ENSMUST00000229614]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000090300
SMART Domains Protein: ENSMUSP00000087770
Gene: ENSMUSG00000060657

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 290 305 N/A INTRINSIC
Pfam:NYN 351 492 1.5e-21 PFAM
RRM 511 579 3.17e-1 SMART
low complexity region 599 610 N/A INTRINSIC
RRM 790 864 4.47e-3 SMART
internal_repeat_2 871 914 1.57e-5 PROSPERO
low complexity region 944 960 N/A INTRINSIC
Pfam:OST-HTH 1096 1167 1e-11 PFAM
low complexity region 1181 1186 N/A INTRINSIC
Pfam:OST-HTH 1256 1328 1.2e-10 PFAM
Pfam:OST-HTH 1332 1404 2.4e-10 PFAM
Pfam:OST-HTH 1408 1480 6.8e-13 PFAM
Pfam:OST-HTH 1483 1555 3e-14 PFAM
low complexity region 1682 1701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229614
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative peroxisomal protein that appears to be conserved across Euteleostomi. In humans, it may be autoantigenic. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit female infertility with abnormalities in oogenic processes including meiotic progression, genomic integrity and acquisition of developmental competence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730522E02Rik T A 11: 25,719,092 (GRCm39) Y17F unknown Het
Aars2 A G 17: 45,825,476 (GRCm39) D313G probably damaging Het
Abca9 A T 11: 110,006,273 (GRCm39) D1277E probably benign Het
Adgrl1 G T 8: 84,661,530 (GRCm39) A981S probably damaging Het
Aff3 T G 1: 38,244,021 (GRCm39) K917Q possibly damaging Het
BC049715 A T 6: 136,816,994 (GRCm39) H78L probably benign Het
Bltp1 C T 3: 37,100,401 (GRCm39) T4707I probably damaging Het
Cacna1g C A 11: 94,301,880 (GRCm39) A2027S possibly damaging Het
Camk1g G A 1: 193,038,709 (GRCm39) probably benign Het
Carf T C 1: 60,183,161 (GRCm39) V386A probably damaging Het
Cd46 A G 1: 194,768,472 (GRCm39) S82P probably benign Het
Clic5 A G 17: 44,581,510 (GRCm39) E180G possibly damaging Het
Col27a1 A G 4: 63,143,898 (GRCm39) T529A probably benign Het
Col7a1 C T 9: 108,809,305 (GRCm39) R2627C unknown Het
Cuzd1 G A 7: 130,913,637 (GRCm39) probably benign Het
Cwc27 T C 13: 104,944,331 (GRCm39) D50G possibly damaging Het
Dhx38 A G 8: 110,281,813 (GRCm39) V735A possibly damaging Het
Dhx57 T G 17: 80,565,550 (GRCm39) E834A probably damaging Het
Dsg4 A G 18: 20,603,936 (GRCm39) D801G probably damaging Het
Dtx1 T C 5: 120,819,464 (GRCm39) E578G probably damaging Het
F830016B08Rik A T 18: 60,433,265 (GRCm39) H116L probably damaging Het
Fbxw18 T C 9: 109,517,907 (GRCm39) I360V possibly damaging Het
Fignl2 G A 15: 100,951,974 (GRCm39) P103S probably benign Het
Frmpd1 A G 4: 45,284,196 (GRCm39) T1006A probably benign Het
Ggnbp2 G T 11: 84,727,200 (GRCm39) C545* probably null Het
Gm3336 A G 8: 71,171,294 (GRCm39) probably benign Het
Gpr37 T C 6: 25,669,290 (GRCm39) N518S probably benign Het
Hbs1l T A 10: 21,218,440 (GRCm39) D312E possibly damaging Het
Hoxd10 C A 2: 74,523,064 (GRCm39) S247R probably benign Het
Ifnb1 A T 4: 88,440,981 (GRCm39) F11I probably benign Het
Myo1f T A 17: 33,820,930 (GRCm39) V879E probably benign Het
Naip1 A G 13: 100,545,656 (GRCm39) F1291L probably benign Het
Nckap1l A G 15: 103,382,586 (GRCm39) E529G probably damaging Het
Npm3 T C 19: 45,736,668 (GRCm39) E157G probably damaging Het
Or10x4 A G 1: 174,218,775 (GRCm39) T47A probably damaging Het
Or4a67 T A 2: 88,597,985 (GRCm39) T225S possibly damaging Het
Or4a68 G T 2: 89,269,740 (GRCm39) N294K probably benign Het
Pex16 G A 2: 92,210,802 (GRCm39) G312D probably damaging Het
Ppp6r1 A G 7: 4,636,286 (GRCm39) V768A probably benign Het
Prrc1 A G 18: 57,495,564 (GRCm39) T14A probably damaging Het
Ranbp2 T C 10: 58,313,105 (GRCm39) L1275P probably damaging Het
Rnf214 C A 9: 45,811,121 (GRCm39) V181F probably damaging Het
Ror2 T C 13: 53,286,040 (GRCm39) N58S probably damaging Het
Selplg G A 5: 113,958,069 (GRCm39) T79I probably damaging Het
Setd1b G A 5: 123,295,500 (GRCm39) G1023S unknown Het
Sf3b2 C T 19: 5,324,852 (GRCm39) D845N probably damaging Het
Skint5 A G 4: 113,562,793 (GRCm39) V803A unknown Het
Slc25a46 T C 18: 31,716,319 (GRCm39) I394M possibly damaging Het
Snrnp27 A T 6: 86,657,935 (GRCm39) I101K possibly damaging Het
Spag17 C A 3: 99,934,906 (GRCm39) T704K probably benign Het
Tas2r144 T A 6: 42,193,058 (GRCm39) M266K possibly damaging Het
Tasor2 A G 13: 3,646,842 (GRCm39) V61A possibly damaging Het
Tbc1d31 T A 15: 57,818,746 (GRCm39) L783H probably benign Het
Tbck C A 3: 132,456,993 (GRCm39) probably benign Het
Vcan A G 13: 89,839,394 (GRCm39) V2050A probably damaging Het
Vmn1r70 T A 7: 10,367,987 (GRCm39) N158K probably damaging Het
Vmn2r103 T A 17: 20,013,121 (GRCm39) Y81N probably benign Het
Vmn2r103 A G 17: 20,013,726 (GRCm39) T173A probably benign Het
Ylpm1 T G 12: 85,061,754 (GRCm39) S552A unknown Het
Zdhhc17 A T 10: 110,817,967 (GRCm39) Y58* probably null Het
Other mutations in Marf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Marf1 APN 16 13,933,606 (GRCm39) missense possibly damaging 0.49
IGL00933:Marf1 APN 16 13,935,221 (GRCm39) missense probably damaging 1.00
IGL01101:Marf1 APN 16 13,964,600 (GRCm39) missense possibly damaging 0.85
IGL02140:Marf1 APN 16 13,959,776 (GRCm39) missense probably damaging 0.99
IGL03196:Marf1 APN 16 13,958,123 (GRCm39) missense possibly damaging 0.64
PIT4283001:Marf1 UTSW 16 13,946,432 (GRCm39) missense probably benign 0.22
R0016:Marf1 UTSW 16 13,970,129 (GRCm39) missense probably damaging 0.99
R0016:Marf1 UTSW 16 13,970,129 (GRCm39) missense probably damaging 0.99
R0046:Marf1 UTSW 16 13,929,591 (GRCm39) missense possibly damaging 0.83
R0046:Marf1 UTSW 16 13,929,591 (GRCm39) missense possibly damaging 0.83
R0056:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0057:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0058:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0058:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0113:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0115:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0179:Marf1 UTSW 16 13,969,040 (GRCm39) missense probably damaging 1.00
R0238:Marf1 UTSW 16 13,969,147 (GRCm39) missense probably benign 0.00
R0238:Marf1 UTSW 16 13,969,147 (GRCm39) missense probably benign 0.00
R0294:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0295:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0316:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0318:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0383:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0391:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0504:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0589:Marf1 UTSW 16 13,959,919 (GRCm39) splice site probably benign
R0603:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0610:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R1240:Marf1 UTSW 16 13,964,626 (GRCm39) missense possibly damaging 0.48
R1445:Marf1 UTSW 16 13,933,688 (GRCm39) missense probably benign
R1716:Marf1 UTSW 16 13,960,450 (GRCm39) missense possibly damaging 0.95
R1921:Marf1 UTSW 16 13,946,465 (GRCm39) missense possibly damaging 0.63
R2098:Marf1 UTSW 16 13,932,064 (GRCm39) missense probably benign 0.00
R2155:Marf1 UTSW 16 13,950,293 (GRCm39) missense probably damaging 0.99
R2177:Marf1 UTSW 16 13,970,471 (GRCm39) missense probably benign 0.01
R2195:Marf1 UTSW 16 13,929,563 (GRCm39) missense probably benign
R2410:Marf1 UTSW 16 13,933,691 (GRCm39) missense probably benign 0.02
R2999:Marf1 UTSW 16 13,960,505 (GRCm39) missense possibly damaging 0.60
R3000:Marf1 UTSW 16 13,960,505 (GRCm39) missense possibly damaging 0.60
R3147:Marf1 UTSW 16 13,943,843 (GRCm39) missense possibly damaging 0.64
R3148:Marf1 UTSW 16 13,943,843 (GRCm39) missense possibly damaging 0.64
R3430:Marf1 UTSW 16 13,958,041 (GRCm39) unclassified probably benign
R3821:Marf1 UTSW 16 13,960,418 (GRCm39) missense probably damaging 1.00
R4383:Marf1 UTSW 16 13,960,505 (GRCm39) missense possibly damaging 0.60
R4384:Marf1 UTSW 16 13,960,505 (GRCm39) missense possibly damaging 0.60
R4520:Marf1 UTSW 16 13,950,530 (GRCm39) missense probably damaging 0.98
R4554:Marf1 UTSW 16 13,971,841 (GRCm39) start gained probably benign
R4557:Marf1 UTSW 16 13,971,841 (GRCm39) start gained probably benign
R4768:Marf1 UTSW 16 13,949,461 (GRCm39) missense possibly damaging 0.93
R4784:Marf1 UTSW 16 13,970,321 (GRCm39) missense probably benign
R4857:Marf1 UTSW 16 13,946,475 (GRCm39) nonsense probably null
R4863:Marf1 UTSW 16 13,950,529 (GRCm39) missense possibly damaging 0.60
R4994:Marf1 UTSW 16 13,932,095 (GRCm39) missense probably benign
R5191:Marf1 UTSW 16 13,963,942 (GRCm39) missense probably damaging 1.00
R5503:Marf1 UTSW 16 13,970,095 (GRCm39) missense probably damaging 0.99
R5813:Marf1 UTSW 16 13,970,449 (GRCm39) missense probably benign 0.35
R5905:Marf1 UTSW 16 13,945,113 (GRCm39) missense probably damaging 0.99
R5960:Marf1 UTSW 16 13,970,281 (GRCm39) missense probably damaging 0.98
R6104:Marf1 UTSW 16 13,935,319 (GRCm39) missense probably damaging 0.99
R6387:Marf1 UTSW 16 13,959,504 (GRCm39) makesense probably null
R6533:Marf1 UTSW 16 13,933,663 (GRCm39) missense probably benign 0.16
R6608:Marf1 UTSW 16 13,950,578 (GRCm39) missense probably damaging 1.00
R6642:Marf1 UTSW 16 13,950,611 (GRCm39) missense probably benign 0.02
R6954:Marf1 UTSW 16 13,956,384 (GRCm39) missense probably damaging 1.00
R6994:Marf1 UTSW 16 13,946,721 (GRCm39) missense probably damaging 1.00
R7010:Marf1 UTSW 16 13,954,865 (GRCm39) missense probably damaging 0.99
R7090:Marf1 UTSW 16 13,929,566 (GRCm39) missense possibly damaging 0.52
R7174:Marf1 UTSW 16 13,954,817 (GRCm39) missense probably damaging 1.00
R7221:Marf1 UTSW 16 13,960,349 (GRCm39) missense probably damaging 1.00
R7247:Marf1 UTSW 16 13,944,957 (GRCm39) missense probably damaging 1.00
R7557:Marf1 UTSW 16 13,950,560 (GRCm39) missense probably damaging 1.00
R7798:Marf1 UTSW 16 13,956,315 (GRCm39) missense probably benign 0.00
R7807:Marf1 UTSW 16 13,971,753 (GRCm39) nonsense probably null
R7855:Marf1 UTSW 16 13,932,065 (GRCm39) missense probably benign 0.27
R7867:Marf1 UTSW 16 13,946,470 (GRCm39) missense probably damaging 0.97
R7893:Marf1 UTSW 16 13,964,599 (GRCm39) missense probably damaging 1.00
R8291:Marf1 UTSW 16 13,950,432 (GRCm39) critical splice donor site probably null
R8746:Marf1 UTSW 16 13,935,168 (GRCm39) missense probably benign 0.18
R8842:Marf1 UTSW 16 13,935,169 (GRCm39) missense probably damaging 1.00
R9253:Marf1 UTSW 16 13,935,172 (GRCm39) missense probably damaging 1.00
R9350:Marf1 UTSW 16 13,963,789 (GRCm39) missense probably damaging 1.00
R9440:Marf1 UTSW 16 13,938,196 (GRCm39) missense probably benign 0.01
R9460:Marf1 UTSW 16 13,947,526 (GRCm39) missense probably damaging 1.00
R9658:Marf1 UTSW 16 13,958,087 (GRCm39) missense probably damaging 1.00
R9698:Marf1 UTSW 16 13,967,077 (GRCm39) missense probably benign 0.00
U24488:Marf1 UTSW 16 13,950,230 (GRCm39) nonsense probably null
X0025:Marf1 UTSW 16 13,932,142 (GRCm39) missense probably damaging 1.00
Z1176:Marf1 UTSW 16 13,933,641 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGGTTGCCAACAACAATGAGGTC -3'
(R):5'- ACTTGAAACTCAGCTCCAGGCATAC -3'

Sequencing Primer
(F):5'- AGGTCTCCTTTTCCATGCC -3'
(R):5'- GTTCAAAGGAAAGCATTTCTGCC -3'
Posted On 2013-04-24