Incidental Mutation 'R3935:Prss36'
ID307132
Institutional Source Beutler Lab
Gene Symbol Prss36
Ensembl Gene ENSMUSG00000070371
Gene Nameprotease, serine 36
Synonymspolyserase-2, C330007D15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3935 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127932638-127946725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127934608 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 8 (L8P)
Ref Sequence ENSEMBL: ENSMUSP00000121706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032988] [ENSMUST00000094026] [ENSMUST00000118755] [ENSMUST00000141385] [ENSMUST00000156152] [ENSMUST00000206124] [ENSMUST00000206568]
Predicted Effect probably benign
Transcript: ENSMUST00000032988
SMART Domains Protein: ENSMUSP00000032988
Gene: ENSMUSG00000030800

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Tryp_SPc 44 281 3.55e-98 SMART
low complexity region 320 338 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000094026
AA Change: L520P

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091565
Gene: ENSMUSG00000070371
AA Change: L520P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 47 287 3.75e-88 SMART
Pfam:Trypsin 325 556 1.2e-16 PFAM
Pfam:Trypsin 599 798 6.6e-20 PFAM
Pfam:DUF1986 607 707 1.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118755
AA Change: L509P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112659
Gene: ENSMUSG00000070371
AA Change: L509P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 47 287 3.75e-88 SMART
Pfam:Trypsin 325 545 9.7e-18 PFAM
Pfam:Trypsin 588 787 6.5e-20 PFAM
Pfam:DUF1986 590 696 8e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141385
AA Change: L8P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120544
Gene: ENSMUSG00000070371
AA Change: L8P

DomainStartEndE-ValueType
Blast:Tryp_SPc 38 121 3e-44 BLAST
SCOP:d1eaxa_ 45 126 7e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144192
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150591
SMART Domains Protein: ENSMUSP00000121532
Gene: ENSMUSG00000070371

DomainStartEndE-ValueType
Tryp_SPc 15 194 6.48e-2 SMART
Blast:Tryp_SPc 231 311 4e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153110
Predicted Effect probably damaging
Transcript: ENSMUST00000156152
AA Change: L8P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121706
Gene: ENSMUSG00000070371
AA Change: L8P

DomainStartEndE-ValueType
Blast:Tryp_SPc 2 44 1e-21 BLAST
Tryp_SPc 89 238 8.18e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206124
Predicted Effect probably benign
Transcript: ENSMUST00000206568
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arx T A X: 93,297,369 L554Q probably damaging Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Bbof1 A G 12: 84,411,210 D83G probably damaging Het
Ccdc47 T C 11: 106,201,997 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Dsc1 T A 18: 20,097,241 T336S probably benign Het
Elk3 A G 10: 93,265,173 S239P possibly damaging Het
Fbll1 T A 11: 35,797,648 I263F probably damaging Het
Fbxw8 T G 5: 118,095,718 I283L probably benign Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Gpr176 A G 2: 118,279,296 V494A probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hoxd11 A G 2: 74,684,032 N302S probably benign Het
Iqgap1 T G 7: 80,743,837 Y664S possibly damaging Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Kif1b T C 4: 149,237,160 N1101D probably benign Het
Kyat1 A G 2: 30,185,749 L376P probably damaging Het
Lztr1 T A 16: 17,522,195 Y93* probably null Het
Nrip1 A G 16: 76,294,435 M78T possibly damaging Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Prg4 A G 1: 150,458,157 I152T possibly damaging Het
Prune2 T C 19: 17,199,786 V2930A probably damaging Het
Ptchd4 G C 17: 42,503,489 L760F possibly damaging Het
Rbms3 A G 9: 116,636,391 L163P probably damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Sirpb1b T A 3: 15,548,783 T80S probably benign Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slmap T C 14: 26,459,415 E411G probably benign Het
Ssu72 C T 4: 155,705,419 S13L probably benign Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tmem80 T C 7: 141,334,025 Y30H probably damaging Het
Other mutations in Prss36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Prss36 APN 7 127944927 splice site probably benign
IGL01473:Prss36 APN 7 127944701 missense probably damaging 0.98
IGL03139:Prss36 APN 7 127933611 missense probably damaging 1.00
R0111:Prss36 UTSW 7 127934545 missense probably damaging 1.00
R0295:Prss36 UTSW 7 127935855 missense possibly damaging 0.80
R1771:Prss36 UTSW 7 127933453 missense probably damaging 1.00
R1827:Prss36 UTSW 7 127933492 missense probably damaging 1.00
R4257:Prss36 UTSW 7 127932838 unclassified probably benign
R4694:Prss36 UTSW 7 127935615 missense probably damaging 1.00
R5384:Prss36 UTSW 7 127936699 missense probably damaging 1.00
R5464:Prss36 UTSW 7 127934233 missense probably damaging 1.00
R5524:Prss36 UTSW 7 127934465 nonsense probably null
R5749:Prss36 UTSW 7 127933642 missense probably damaging 1.00
R5905:Prss36 UTSW 7 127933572 missense probably benign 0.26
R5992:Prss36 UTSW 7 127944830 missense probably damaging 1.00
R6033:Prss36 UTSW 7 127934567 missense probably benign 0.07
R6033:Prss36 UTSW 7 127934567 missense probably benign 0.07
R6971:Prss36 UTSW 7 127945238 missense probably benign 0.15
R7050:Prss36 UTSW 7 127944765 missense possibly damaging 0.71
R7232:Prss36 UTSW 7 127935591 missense probably benign 0.07
R7271:Prss36 UTSW 7 127944705 missense probably benign 0.10
R8679:Prss36 UTSW 7 127933463 missense possibly damaging 0.89
Z1088:Prss36 UTSW 7 127934537 nonsense probably null
Z1177:Prss36 UTSW 7 127933833 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCGTGCTCAGTATGTGTGG -3'
(R):5'- GCTTGTCAGTTTGAAGAAAGGG -3'

Sequencing Primer
(F):5'- CTCAGTATGTGTGGGACAAGTC -3'
(R):5'- ATCTCAGAGTTCGAGGACAGCC -3'
Posted On2015-04-17